IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

Identification og unknown bacterium from Ganges ("wierd bacterium")

Trond Erik Vee Aune trondaun at biotech.NOSPAM.ntnu.no
Mon Apr 28 23:48:16 EST 2003



Artem Evdokimov wrote:
> Hi,
> 
> Congratulations on the ID. Remind us, did your bug have flagella ? P. alvei
> is supposed to be flagellated... It is a common beehive parasite if memory
> serves right, it can be found on dead bee larvae. It sporulates with spores
> positioned in almost ordered rows. Sorry to hear that your bug isn't brand
> new...

Yes, it was highly motile and swarmed in a very fascinating way. That's 
why I decided to identify it. I looked for spores in the microscope, but 
couldn't see any, so maybe the cells were in the wrong growth phase.

Trond Erik

> 
> Artem
> 
> 
> "Trond Erik Vee Aune" <trondaun at biotech.REMOVETHISBEFOREREPLYING.ntnu.no>
> wrote in message
> news:3EAD0F42.2000002 at biotech.REMOVETHISBEFOREREPLYING.ntnu.no...
> 
>>Hi all,
>>
>>I just received the sequencing data of the "wierd bacterium" we've been
>>talking about earlier. Unfortunately, the sequence was not very good,
>>but I did get what I thnik is convincing results when blasting. I have
>>pasted the sequence so that you can check it out yourselves if you're
>>interested.
>>
>>Anyway, I got very good match against Paenibacillus alvei. According to
>>web-resources this genus do produce different types of antibiotics as
>>well as being able to swarm in different ways
>>(http://ijs.sgmjournals.org/cgi/reprint/49/1/239.pdf). The strange thing
>>is that it is not a gram negative bug as I thought after staining, but
>>one of you microbiologists suggested that I was a Bacillus strain, so I
>>guess we geneticists are much better at sequencing than staining ;)
>>Anyway, I'm pretty pleased that I finally got an identification, but of
>>course a little disappointed that it wasn't a new bacterium
>>
>>Forward sequence:
>>
> 
> GGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGGACTTGATGGAGTGCTTGCACTCCTGATGGTTAG
> CGGC
> 
> GGACGGGTGAGTAACACGTACGTAACCTGCCCATAAGACTGGGATAACCCACNGAAACGTGAGCTANTACCANATN
> GGCN
> 
> TTTTCCTCGCATGAGGGAAATNAGAAAGGCGGATCAATCTGTCNCTTATGGATGGACCTGCGGNGCATTATCTAGT
> TGGT
> 
> GAGGTAACGGCTNACCAAGGCGACGATGCGTNCCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGANACACGG
> TCCC
> 
> AGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTNTGACGGAGCAACGCCGTCGTGAGTG
> ATNA
> 
> ANGTTTTCNGATCGTAAAGCTCTGNTGCCANGGAANAACGCCTAGGAGAGTNACTNCTCTTAGGGNGACGGNNCCT
> GAGA
> 
> AGAAAGCCCCTNCTAACTACNTGCCANCAGCCGNGGTANTACGTANGGGGCGAGCGTNNNCCANANTTATTNGGCT
> TAAA
> 
> GCGCGCNCAGGCAGNAATNTAAGTTGGGTGTTTAAACCTAGGGCTCAACCTTGGGNCGCATNCAAAACTGCATANC
> TNGA
> 
>>NTACAGAAAGAGGAAAGNGGAATNCCNCGTGTTCCNGNGAAATGCGTANAGATNTCNAGGAACACNATTGN
>>
>>
>>Reverse sequence:
>>
> 
> GGNACCCCAATCATCTACCCCACCTTCGGCGGCTGGCNCCTTGCGGTTACCTCACCGACTTCGGGTGTTGTAAACT
> CTCG
> 
> TGGTGTGACGGGCGGNGTGTACAAGACCCGGGAACGTATTCACCGCTGGCATGCTGATCCGCGATTACTAGCAATT
> CCGA
> 
> CTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGACTGGCTTTTTAGGATTGGCTNCACCTCGCGGNTTCG
> CTTC
> 
> CCGATGTACCAGCCATTGTAGNACGTGNGTAGCCCAGGTCATAAGGGGCATGATGATTNGANNTNATNCTCACCTT
> CCTC
> 
> CGGTACTGTCACCGGCAGGCACTNTAGAGTGNCCAACTGAATGCTGGCAANTAAAGANAAAGGTTGCGCTCGTGAG
> CGGG
> 
> ACTTAACCCAACATTTNACAACANNAGCTGACGACAACCATNCACNACCNGANTANAAATGTCCNNANAGAAAGCC
> CTAT
> 
> CTCTAGAACGNNCCTTCATATNTCAAGACCTGGTAAGGNTNTTNCCGTTGCTTCNAATTTNACCCCATACTTCACT
> GCNT
> 
> TTNCCNGCNCCCCGCNCGTTCCTTTTAGNTTTCAAGTCTTTNCGCACCGTGCTTCCCCACGCGGAATGCTTTAATG
> ANTT
> 
> ACTTTCTNCCCCAAGGGAAATAGAAAACCCGNAATACCNAGTCTTNCTTGNTATACCNGCTNGGGCTTNCGGGGNA
> TCNA
> 
> ATNCCGTTTGCTCCNNCTTCCTTTCTCCNCNTNNCNNNTNGNTNCCNCCCNANAGGCNNCTTCCCCNATGGGATNC
> CTCN
> 
> CNTNCTCCNCTAGNNCCGNAAACTNGGTAAGAAGATNNTTTTTCTNNNAACNAGTAANTCTAAACGNACCACNNGG
> GATN
> 
> GGNAAAATAANTAATANANANAGGNACTAGACCAAGNTNNNGAGATNNTACCNAAAANNAANTTAGGGATNAGANA
> NAGN
> 
>>NTTTTANACTACT
>>
>>If you have any more information about this bacterium, please tell me,
>>I'm interested :)
>>
>>Regards,
>>Trond Erik
>>
>>
>>--
>>Trond Erik Vee Aune
>>Department of Biotechnology
>>Norwegian University of Science and Technology
>>Email: trondaun at biotech.ntnu.no
>>http://www.REMOVETHISBEFOREREPLYING!!biotech.ntnu.no/molgen
>>
> 
> 
> 




More information about the Microbio mailing list

Send comments to us at biosci-help [At] net.bio.net