IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

Identification og unknown bacterium from Ganges ("wierd bacterium")

Trond Erik Vee Aune trondaun at biotech.REMOVETHISBEFOREREPLYING.ntnu.no
Mon Apr 28 07:58:56 EST 2003



Subhash Kulkarni wrote:
> hi,
> good to see the results at last, the sequencing does suggest that as 
> predicted its not gram negative and does indeed belong to bacillus. i 
> suggested that it is a bacillus type rather than a gram negative, and 
> dear geneticist, it does confirm that experience can save u some amount 
> of work when u have foresight to do so...

:) Well, even if i did get a convincing stain I would have done the 
sequencing, I would never settle for just stain information.

> cheers with the results
> subhash
> PS: whats the thing with these bacteria being from ganges???

Just a friend of mine who brought some water sample fra Ganges, 
something I've been playing around with on my spare time. Well, I 
haven't been "playing around" with the water considering all the 
potential harmful bugs that are probably in there ;)...But I have done 
som tests to establish what kind of microorganisms is in the water.

Trond Erik

> 
> Trond Erik Vee Aune wrote:
> 
>> Hi all,
>>
>> I just received the sequencing data of the "wierd bacterium" we've 
>> been talking about earlier. Unfortunately, the sequence was not very 
>> good, but I did get what I thnik is convincing results when blasting. 
>> I have pasted the sequence so that you can check it out yourselves if 
>> you're interested.
>>
>> Anyway, I got very good match against Paenibacillus alvei. According 
>> to web-resources this genus do produce different types of antibiotics 
>> as well as being able to swarm in different ways 
>> (http://ijs.sgmjournals.org/cgi/reprint/49/1/239.pdf). The strange 
>> thing is that it is not a gram negative bug as I thought after 
>> staining, but one of you microbiologists suggested that I was a 
>> Bacillus strain, so I guess we geneticists are much better at 
>> sequencing than staining ;) Anyway, I'm pretty pleased that I finally 
>> got an identification, but of course a little disappointed that it 
>> wasn't a new bacterium
>>
>> Forward sequence:
>> GGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGGACTTGATGGAGTGCTTGCACTCCTGATGGTTAGCGGC 
>>
>> GGACGGGTGAGTAACACGTACGTAACCTGCCCATAAGACTGGGATAACCCACNGAAACGTGAGCTANTACCANATNGGCN 
>>
>> TTTTCCTCGCATGAGGGAAATNAGAAAGGCGGATCAATCTGTCNCTTATGGATGGACCTGCGGNGCATTATCTAGTTGGT 
>>
>> GAGGTAACGGCTNACCAAGGCGACGATGCGTNCCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGANACACGGTCCC 
>>
>> AGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTNTGACGGAGCAACGCCGTCGTGAGTGATNA 
>>
>> ANGTTTTCNGATCGTAAAGCTCTGNTGCCANGGAANAACGCCTAGGAGAGTNACTNCTCTTAGGGNGACGGNNCCTGAGA 
>>
>> AGAAAGCCCCTNCTAACTACNTGCCANCAGCCGNGGTANTACGTANGGGGCGAGCGTNNNCCANANTTATTNGGCTTAAA 
>>
>> GCGCGCNCAGGCAGNAATNTAAGTTGGGTGTTTAAACCTAGGGCTCAACCTTGGGNCGCATNCAAAACTGCATANCTNGA 
>>
>> NTACAGAAAGAGGAAAGNGGAATNCCNCGTGTTCCNGNGAAATGCGTANAGATNTCNAGGAACACNATTGN
>>
>>
>> Reverse sequence:
>> GGNACCCCAATCATCTACCCCACCTTCGGCGGCTGGCNCCTTGCGGTTACCTCACCGACTTCGGGTGTTGTAAACTCTCG 
>>
>> TGGTGTGACGGGCGGNGTGTACAAGACCCGGGAACGTATTCACCGCTGGCATGCTGATCCGCGATTACTAGCAATTCCGA 
>>
>> CTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGACTGGCTTTTTAGGATTGGCTNCACCTCGCGGNTTCGCTTC 
>>
>> CCGATGTACCAGCCATTGTAGNACGTGNGTAGCCCAGGTCATAAGGGGCATGATGATTNGANNTNATNCTCACCTTCCTC 
>>
>> CGGTACTGTCACCGGCAGGCACTNTAGAGTGNCCAACTGAATGCTGGCAANTAAAGANAAAGGTTGCGCTCGTGAGCGGG 
>>
>> ACTTAACCCAACATTTNACAACANNAGCTGACGACAACCATNCACNACCNGANTANAAATGTCCNNANAGAAAGCCCTAT 
>>
>> CTCTAGAACGNNCCTTCATATNTCAAGACCTGGTAAGGNTNTTNCCGTTGCTTCNAATTTNACCCCATACTTCACTGCNT 
>>
>> TTNCCNGCNCCCCGCNCGTTCCTTTTAGNTTTCAAGTCTTTNCGCACCGTGCTTCCCCACGCGGAATGCTTTAATGANTT 
>>
>> ACTTTCTNCCCCAAGGGAAATAGAAAACCCGNAATACCNAGTCTTNCTTGNTATACCNGCTNGGGCTTNCGGGGNATCNA 
>>
>> ATNCCGTTTGCTCCNNCTTCCTTTCTCCNCNTNNCNNNTNGNTNCCNCCCNANAGGCNNCTTCCCCNATGGGATNCCTCN 
>>
>> CNTNCTCCNCTAGNNCCGNAAACTNGGTAAGAAGATNNTTTTTCTNNNAACNAGTAANTCTAAACGNACCACNNGGGATN 
>>
>> GGNAAAATAANTAATANANANAGGNACTAGACCAAGNTNNNGAGATNNTACCNAAAANNAANTTAGGGATNAGANANAGN 
>>
>> NTTTTANACTACT
>>
>> If you have any more information about this bacterium, please tell me, 
>> I'm interested :)
>>
>> Regards,
>> Trond Erik
>>
>>
> 


-- 
Trond Erik Vee Aune
Department of Biotechnology
Norwegian University of Science and Technology
Email: trondaun at biotech.ntnu.no
http://www.REMOVETHISBEFOREREPLYING!!biotech.ntnu.no/molgen




More information about the Microbio mailing list

Send comments to us at biosci-help [At] net.bio.net