IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

Identification og unknown bacterium from Ganges ("wierd bacterium")

Subhash Kulkarni Subhash.Kulkarni at nospam.ie-zea.unil.ch
Mon Apr 28 07:52:01 EST 2003


hi,
good to see the results at last, the sequencing does suggest that as 
predicted its not gram negative and does indeed belong to bacillus. i 
suggested that it is a bacillus type rather than a gram negative, and 
dear geneticist, it does confirm that experience can save u some amount 
of work when u have foresight to do so...
cheers with the results
subhash
PS: whats the thing with these bacteria being from ganges???

Trond Erik Vee Aune wrote:
> Hi all,
> 
> I just received the sequencing data of the "wierd bacterium" we've been 
> talking about earlier. Unfortunately, the sequence was not very good, 
> but I did get what I thnik is convincing results when blasting. I have 
> pasted the sequence so that you can check it out yourselves if you're 
> interested.
> 
> Anyway, I got very good match against Paenibacillus alvei. According to 
> web-resources this genus do produce different types of antibiotics as 
> well as being able to swarm in different ways 
> (http://ijs.sgmjournals.org/cgi/reprint/49/1/239.pdf). The strange thing 
> is that it is not a gram negative bug as I thought after staining, but 
> one of you microbiologists suggested that I was a Bacillus strain, so I 
> guess we geneticists are much better at sequencing than staining ;) 
> Anyway, I'm pretty pleased that I finally got an identification, but of 
> course a little disappointed that it wasn't a new bacterium
> 
> Forward sequence:
> GGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGGACTTGATGGAGTGCTTGCACTCCTGATGGTTAGCGGC 
> 
> GGACGGGTGAGTAACACGTACGTAACCTGCCCATAAGACTGGGATAACCCACNGAAACGTGAGCTANTACCANATNGGCN 
> 
> TTTTCCTCGCATGAGGGAAATNAGAAAGGCGGATCAATCTGTCNCTTATGGATGGACCTGCGGNGCATTATCTAGTTGGT 
> 
> GAGGTAACGGCTNACCAAGGCGACGATGCGTNCCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGANACACGGTCCC 
> 
> AGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTNTGACGGAGCAACGCCGTCGTGAGTGATNA 
> 
> ANGTTTTCNGATCGTAAAGCTCTGNTGCCANGGAANAACGCCTAGGAGAGTNACTNCTCTTAGGGNGACGGNNCCTGAGA 
> 
> AGAAAGCCCCTNCTAACTACNTGCCANCAGCCGNGGTANTACGTANGGGGCGAGCGTNNNCCANANTTATTNGGCTTAAA 
> 
> GCGCGCNCAGGCAGNAATNTAAGTTGGGTGTTTAAACCTAGGGCTCAACCTTGGGNCGCATNCAAAACTGCATANCTNGA 
> 
> NTACAGAAAGAGGAAAGNGGAATNCCNCGTGTTCCNGNGAAATGCGTANAGATNTCNAGGAACACNATTGN
> 
> 
> Reverse sequence:
> GGNACCCCAATCATCTACCCCACCTTCGGCGGCTGGCNCCTTGCGGTTACCTCACCGACTTCGGGTGTTGTAAACTCTCG 
> 
> TGGTGTGACGGGCGGNGTGTACAAGACCCGGGAACGTATTCACCGCTGGCATGCTGATCCGCGATTACTAGCAATTCCGA 
> 
> CTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGACTGGCTTTTTAGGATTGGCTNCACCTCGCGGNTTCGCTTC 
> 
> CCGATGTACCAGCCATTGTAGNACGTGNGTAGCCCAGGTCATAAGGGGCATGATGATTNGANNTNATNCTCACCTTCCTC 
> 
> CGGTACTGTCACCGGCAGGCACTNTAGAGTGNCCAACTGAATGCTGGCAANTAAAGANAAAGGTTGCGCTCGTGAGCGGG 
> 
> ACTTAACCCAACATTTNACAACANNAGCTGACGACAACCATNCACNACCNGANTANAAATGTCCNNANAGAAAGCCCTAT 
> 
> CTCTAGAACGNNCCTTCATATNTCAAGACCTGGTAAGGNTNTTNCCGTTGCTTCNAATTTNACCCCATACTTCACTGCNT 
> 
> TTNCCNGCNCCCCGCNCGTTCCTTTTAGNTTTCAAGTCTTTNCGCACCGTGCTTCCCCACGCGGAATGCTTTAATGANTT 
> 
> ACTTTCTNCCCCAAGGGAAATAGAAAACCCGNAATACCNAGTCTTNCTTGNTATACCNGCTNGGGCTTNCGGGGNATCNA 
> 
> ATNCCGTTTGCTCCNNCTTCCTTTCTCCNCNTNNCNNNTNGNTNCCNCCCNANAGGCNNCTTCCCCNATGGGATNCCTCN 
> 
> CNTNCTCCNCTAGNNCCGNAAACTNGGTAAGAAGATNNTTTTTCTNNNAACNAGTAANTCTAAACGNACCACNNGGGATN 
> 
> GGNAAAATAANTAATANANANAGGNACTAGACCAAGNTNNNGAGATNNTACCNAAAANNAANTTAGGGATNAGANANAGN 
> 
> NTTTTANACTACT
> 
> If you have any more information about this bacterium, please tell me, 
> I'm interested :)
> 
> Regards,
> Trond Erik
> 
> 




More information about the Microbio mailing list

Send comments to us at biosci-help [At] net.bio.net