IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

Identification og unknown bacterium from Ganges ("wierd bacterium")

Trond Erik Vee Aune trondaun at biotech.REMOVETHISBEFOREREPLYING.ntnu.no
Mon Apr 28 06:23:46 EST 2003


Hi all,

I just received the sequencing data of the "wierd bacterium" we've been 
talking about earlier. Unfortunately, the sequence was not very good, 
but I did get what I thnik is convincing results when blasting. I have 
pasted the sequence so that you can check it out yourselves if you're 
interested.

Anyway, I got very good match against Paenibacillus alvei. According to 
web-resources this genus do produce different types of antibiotics as 
well as being able to swarm in different ways 
(http://ijs.sgmjournals.org/cgi/reprint/49/1/239.pdf). The strange thing 
is that it is not a gram negative bug as I thought after staining, but 
one of you microbiologists suggested that I was a Bacillus strain, so I 
guess we geneticists are much better at sequencing than staining ;) 
Anyway, I'm pretty pleased that I finally got an identification, but of 
course a little disappointed that it wasn't a new bacterium

Forward sequence:
GGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGGACTTGATGGAGTGCTTGCACTCCTGATGGTTAGCGGC
GGACGGGTGAGTAACACGTACGTAACCTGCCCATAAGACTGGGATAACCCACNGAAACGTGAGCTANTACCANATNGGCN
TTTTCCTCGCATGAGGGAAATNAGAAAGGCGGATCAATCTGTCNCTTATGGATGGACCTGCGGNGCATTATCTAGTTGGT
GAGGTAACGGCTNACCAAGGCGACGATGCGTNCCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGANACACGGTCCC
AGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTNTGACGGAGCAACGCCGTCGTGAGTGATNA
ANGTTTTCNGATCGTAAAGCTCTGNTGCCANGGAANAACGCCTAGGAGAGTNACTNCTCTTAGGGNGACGGNNCCTGAGA
AGAAAGCCCCTNCTAACTACNTGCCANCAGCCGNGGTANTACGTANGGGGCGAGCGTNNNCCANANTTATTNGGCTTAAA
GCGCGCNCAGGCAGNAATNTAAGTTGGGTGTTTAAACCTAGGGCTCAACCTTGGGNCGCATNCAAAACTGCATANCTNGA
NTACAGAAAGAGGAAAGNGGAATNCCNCGTGTTCCNGNGAAATGCGTANAGATNTCNAGGAACACNATTGN


Reverse sequence:
GGNACCCCAATCATCTACCCCACCTTCGGCGGCTGGCNCCTTGCGGTTACCTCACCGACTTCGGGTGTTGTAAACTCTCG
TGGTGTGACGGGCGGNGTGTACAAGACCCGGGAACGTATTCACCGCTGGCATGCTGATCCGCGATTACTAGCAATTCCGA
CTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGACTGGCTTTTTAGGATTGGCTNCACCTCGCGGNTTCGCTTC
CCGATGTACCAGCCATTGTAGNACGTGNGTAGCCCAGGTCATAAGGGGCATGATGATTNGANNTNATNCTCACCTTCCTC
CGGTACTGTCACCGGCAGGCACTNTAGAGTGNCCAACTGAATGCTGGCAANTAAAGANAAAGGTTGCGCTCGTGAGCGGG
ACTTAACCCAACATTTNACAACANNAGCTGACGACAACCATNCACNACCNGANTANAAATGTCCNNANAGAAAGCCCTAT
CTCTAGAACGNNCCTTCATATNTCAAGACCTGGTAAGGNTNTTNCCGTTGCTTCNAATTTNACCCCATACTTCACTGCNT
TTNCCNGCNCCCCGCNCGTTCCTTTTAGNTTTCAAGTCTTTNCGCACCGTGCTTCCCCACGCGGAATGCTTTAATGANTT
ACTTTCTNCCCCAAGGGAAATAGAAAACCCGNAATACCNAGTCTTNCTTGNTATACCNGCTNGGGCTTNCGGGGNATCNA
ATNCCGTTTGCTCCNNCTTCCTTTCTCCNCNTNNCNNNTNGNTNCCNCCCNANAGGCNNCTTCCCCNATGGGATNCCTCN
CNTNCTCCNCTAGNNCCGNAAACTNGGTAAGAAGATNNTTTTTCTNNNAACNAGTAANTCTAAACGNACCACNNGGGATN
GGNAAAATAANTAATANANANAGGNACTAGACCAAGNTNNNGAGATNNTACCNAAAANNAANTTAGGGATNAGANANAGN
NTTTTANACTACT

If you have any more information about this bacterium, please tell me, 
I'm interested :)

Regards,
Trond Erik


-- 
Trond Erik Vee Aune
Department of Biotechnology
Norwegian University of Science and Technology
Email: trondaun at biotech.ntnu.no
http://www.REMOVETHISBEFOREREPLYING!!biotech.ntnu.no/molgen




More information about the Microbio mailing list

Send comments to us at biosci-help [At] net.bio.net