IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

codon frequency tables

jun at nih.go.jp jun at nih.go.jp
Fri Jun 18 04:55:09 EST 1999


In article <Pine.SGI.4.05.9906171658290.234692-100000 at meije.rsvs.ulaval.ca> proy at rsvs.ulaval.ca (Paul Roy) writes:

>      Do you know of anyone who has a database of codon frequency tables in
> GCG format?  There was a large database of tables at a Japanese site (but
> not in GCG format) and a smaller one (which our system lost when version
> 10 was installed) which originally came from EGCG version 8.1.  I don't
> know if it would still be available at EBI.  Or has anyone written a
> program to reformat the Japanese database?

I used the cutg2gcg, a perl script written by E. L. Cabot, for
reformatting CUTG tables. But I can not remember where I got it^^;

--
ISHIKAWA Jun, Ph.D.            Natl. Inst. of Infectious Diseases
(jun at nih.go.jp)                Dept. of Bioactive Molecules
AUCUCCCACAUCAAAGCUUGGGCU       Tokyo 162-8640, JAPAN
http://www.nih.go.jp/~jun/research/ 




More information about the Info-gcg mailing list

Send comments to us at biosci-help [At] net.bio.net