IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

gcg9.1 PlasmimaP

jun at nih.go.jp jun at nih.go.jp
Wed May 6 23:51:13 EST 1998


In article <6ip9j7$gdh at sansgene.genethon.fr> vcussac at sansgene.genethon.fr (Valerie Cussac) writes:

> Is there somebody who know how to use Plasmidmap with seqlab in gcg9.1,
> What I want in fact is to have rapidly a map of a plasmid from a sequence file.
> I've in a file the sequence of a plasmid (PBR322 for example) in gcg format
> and is it possible to have easily by Plasmidmap the map of this plasmid?
> Anybody used Plasmidmap usually?

As described in the GCG manual, you should run mapsort command
first with -plasmid option, and then invoke plasmidmap command:

% mapsort -plasmid pbr322.seq
% plasmidmap pbr322.tick

Good Luck:-)

--
ISHIKAWA Jun, Ph.D.            Natl. Inst. of Infectious Diseases
(jun at nih.go.jp)                Dept. of Bioactive Molecules
AUCUCCCACAUCAAAGCUUGGGCU       Tokyo 162-8640, JAPAN
http://www.nih.go.jp/~jun/research/ 



More information about the Info-gcg mailing list

Send comments to us at biosci-help [At] net.bio.net