IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

reading sequence data from stdin

ISHIKAWA Jun jun at nih.go.jp
Fri Apr 18 01:47:47 EST 1997


Can GCG commands, especially blast and motifs, read sequence
data from standard input?

--
 ISHIKAWA Jun, Ph.D.       National Institute of Infectious Disease
 (jun at nih.go.jp)           Dept. of Bioactive Molecules
 ATCTCCCACATCAAGGCCTGGGCC  Tokyo, JAPAN
 <http://www.nih.go.jp/~jun/research/>



More information about the Info-gcg mailing list

Send comments to us at biosci-help [At] net.bio.net