IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

strange behaviour of GCG's fasta

Guy Bottu gbottu at ben.vub.ac.be
Fri May 3 07:46:26 EST 1996


One of our users searched a primer against a databank and could not
retrieve the sequence for which the primer was optimized. The
reason turned out to be that :

the sequence is ACNACNAGGTCNCCRTCYTTGATGAT

fasta against the sequence vi:U44402 yields :

SCORES           Init1:    32 Initn:    32 Opt:    88
            80.8% identity in 26 bp overlap

                                           19         9
gbvca1                               ATCATCAARGAYGGNGACCTNGTNGT
                                     ||||||||:||:||:|||||:||:||
u44402 ATTGCCTATTATAGGGGTAAAGACAGTTCTATCATCAAGGATGGGGACCTGGTGGTCTGT
         4400      4410      4420      4430      4440      4450

while fasta against vi:HG25543 yields :

SCORES           Init1:    80 Initn:    80 Opt:    88
            80.8% identity in 26 bp overlap

                                           19         9
gbvca1                               ATCATCAARGAYGGNGACCTNGTNGT
                                     ||||||||:||:||:|||||:||:||
hg2554 ATTGCTTATTATAGGGGCAAAGACAGTTCCATCATCAAGGACGGAGACCTAGTGGTGTGC
      120       130       140       150       160       170

The sequence vi:U44402 is evidently not found because its Initn score
is lower than the Initn score of vi:HG25543 and many other sequences
and thus sinks so far away in the list of hits that you do not look
at it. But how is it possible that identical alignments are scored
so differently ?

 	Guy Bottu



More information about the Info-gcg mailing list

Send comments to us at biosci-help [At] net.bio.net