In <3119BCE2.41C6 at molbiol.ox.ac.uk> Ewan writes:
> Chris Barry wrote:
> >
> > Could someone tell me how to import a raw sequence file on GCG? Thanks
> >
> > Chris
>> The easiest way is to make the raw sequence file a fasta (pearson)
> format file
>>> Thus if your file looks like
> ------------------------------------------------
> aaaatgtgtattatataaahagagaaaatatatatatatata
> tagagatgatagatagagagatagaataggggtgatagatagat
>>> then simply add a >name_of_sequence in an editor
> so it looks like
>> ------------------------------------------------
> >first_sequence
> aaaatgtgtattatataaahagagaaaatatatatatatata
> tagagatgatagatagagagatagaataggggtgatagatagat
>>> and then use fromfasta to get it to a GCG sequence
Using
reformat my.sequence gcg.sequence
will do it without any modification of the file (provided my.sequence doesn't
contain anything else but sequence characters).
Regards,
Christoph Gartmann
+----------------------------------------------------------------------------+
| Max-Planck-Institut fuer Phone : +49-761-5108-465 Fax: -221 |
| Immunbiologie PSI : PSI%(0262)45050160374::GARTMANN |
| Postfach 1169 Internet: gartmann at immunbio.mpg.de |
| D-79011 Freiburg, FRG |
+----------- Do you know MENUE, the user environment for OpenVMS? -----------+
