Hi, everyone:
This post is via cs.utexas.edu mail-to-news gateway. After I sent
one post with the same content, I didn't see it on the corresponding
newsgroups for quite a while. Now, I am sending it again. If somehow the old
one appears, please excuse me for that.
Today is 02/03/95, Now is 09:24 am CST, USA
Hello, everyone:
How many times did you ask yourself that you could use your favorite
word processing softwares to edit your sequences and export these sequence
files out to the VAX/VMS system? How many times did you wonder whether you
could use your PC or MAC instead of a work-ladden VAX/VMS system to edit your
sequence? Have you wondered whether you could run a simple program to arrange
your sequence to get a nice format for your word processing softwares?
Now and here comes the program which you wish that you could have
programmed. Here, I announce that a simple DOS program, EDNA, is available to
the molecular biology research community. This EDNA program is quite like the
reformat program in the GCG package for the OpenVMS/VAX system. However, it
gives more freedom to edit your sequence with your softwares. You can put
your comments anywhere in the file as long as they are enclosed with a pair
of /* */ marks. It also automatically puts a space between any consequent
periods which you put in the comment part. The output file is in the GCG
format.
Here is an example:
------------------------------------------------------------------------------
Input file INPUT.TXT
/* This is first comment... */ GGGGAAaaaa 10 cttt
tctttttttaaaaaaaaaaaattttttttttttttttt
/* This is second comment */
ttttttttaaaaaggcttttaaaggg
Output file INPUT.SEQ
This is first comment. . .
This is second comment
THIS.SEQ Length: 78 February 01, 1995 21:41 Type: N Check: 7333 ..
1 GGGGAAaaaa cttttctttt tttaaaaaaa aaaaattttt tttttttttt
51 tttttttttt aaaaaggctt ttaaaggg
------------------------------------------------------------------------------
If you are interested, please drop me a line and I will mail you the
uuencoded file with instructions attached.
Thank you for your interest.
Mr. Yinrong HUANG
Thursday February 2, 1995, 07:42pm CST USA
------------------------------------------------------------------------------
| * * * Many people don't know how to use computer softwares, * * * |
| * * let alone know how they are programmed and how they work. * * |
| * * * This email ONLY represents my own personal viewpoints. * * * |
| * * * * With Standard Disclaim included * * * * |
------------------------------------------------------------------------------
