IUBio

ambiguity codes in fasta??

Bo Servenius Bo.Servenius at wblab.lu.se
Fri Feb 11 11:20:41 EST 1994


Dear Netters:

I have tried to compare a degenerative oligonucleotide with the databases
using fasta. However checkeing the result I realize fasta can not
understand that ambiguitycodes can mean an identity not only a similarity.

see following example

SCORES     Init1: 112 Initn: 112 Opt: 112
            78.1% identity in 32 bp overlap

                                             10        20        30
E1B-20                               CARGARAANGTSATCAARACYTTRGATTTT
                                     ||:||:||:||:|||||:||:||:||||||
ad5001 TCTTTGAATCTGGGTCACCAGGCGCTTTTCCAAGAGAAGGTCATCAAGACTTTGGATTTT
           1910      1920      1930      1940      1950      1960


E1B-20 TC
       ||
ad5001 TCCACACCGGGGCGCGCTGCGGCTGCTGTTGCTTTTTTGAGTTTTATAAAGGATAAATGG
           1970      1980      1990      2000      2010      2020


In this comparison I would like the program to realize that the  oligo
E1B-20 in fact is 100% homologous to tha ad5001 sequence.

Do anyone have any suggestion how this could be done with the gcg package
or any  netservices?

Yours

BOSSE



More information about the Info-gcg mailing list

Send comments to us at biosci-help [At] net.bio.net