IUBio

Information about an EST sequence

Cavanaugh, Mark (NIH/NLM/NCBI) cavanaug at ncbi.nlm.nih.gov
Fri Mar 25 18:13:51 EST 2005


Thanks for passing along the information about EMBL's SVA.

NCBI does provide access to all old versions of non-EST records.
For example, try accession AC074315 at this URL :

	http://www.ncbi.nlm.nih.gov/entrez/sutils/girevhist.cgi

However, this functionality does not extend to EST sequences
**unless** a sequence change is involved. So the EMBL SVA is a
nice complementary resource .

Regards,

Mark Cavanaugh
GenBank
NCBI/NLM/NIH/HHS


>From: [iso-8859-1] BERNARDI C=E9line [mailto:CBERNARDI at rd.loreal.com] 
>Sent: Thursday, March 24, 2005 10:48 AM
>To: genbank at net.bio.net
>Subject: RE : Information about an EST sequence
>
>Dear Mr Cavanaugh,
>
>Thank you for these information.
>
>In the meantime, I went on with my search, and I found that on 
>EMBL, with
>the following link:
>
>http://www.ebi.ac.uk/cgi-bin/sva/sva.pl?query=3DAI791495&search
>=3DGo&snapsh=
>ot=3D
>
>I can have the whole history of the modifications (and I got 
>the informatio=
>n
>I wanted, i.e. the sequence was not modified).
>
>Thank you again for your help,
>
>Best regards,
>C=E9line BERNARDI
---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at bioinformatics.ubc.ca                  





More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net