Dear Sirs,=20
I send you this email in order to have specific information about the EST
which has the Accession number AI791495.=20
Indeed, I have seen that this sequence was first seen at NCBI on July 2,
1999; it was then updated on December 13, 1999.
How can I see the first version (of July 2)? Is it possible to see the
different modifications which occurred between July 2 and December 13?
Thank you in advance for your response,=20
Best regards,=20
C=E9line BERNARDI=20
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/ =20
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb =
=20
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at bioinformatics.ubc.ca =
=20
