Missing Sequence Versions in nc0630 GenBank Update files

[Mark Cavanaugh]

Greetings GenBank Users,

The ASN.1 and GenBank flatfile versions of the 0630 GenBank Incremental
Update (GIU) :

	ftp://ftp.ncbi.nih.gov/ncbi-asn1/nc0630.aso.gz
	ftp://ftp.ncbi.nih.gov/genbank/nc0630.flat.gz

contain 128 sequence records which lack sequence version numbers. For example,
from the 0630 flatfile :

LOCUS       AY208508                1140 bp    DNA     linear   VRT 26-JUN-2003
DEFINITION  Amphiprion akallopisos isolate stri-x-1578 cytochrome b gene,
            complete cds; mitochondrial gene for mitochondrial product.
ACCESSION   AY208508
VERSION     AY208508  GI:32263642
                   ^^^

Normally, a sequence version number is appended after the accession number
on the VERSION line.

This problem was addressed on 6/30. The nc0701 GIU's made available on the
following day contain repaired versions of the 128 records. For example:

LOCUS       AY208508                1140 bp    DNA     linear   VRT 30-JUN-2003
DEFINITION  Amphiprion akallopisos isolate stri-x-1578 cytochrome b gene,
            complete cds; mitochondrial gene for mitochondrial product.
ACCESSION   AY208508
VERSION     AY208508.1  GI:32263642


The cause of this error is related to recent changes in how NCBI stores
hold-until-publish sequence records. When the HUP-dates for these 128
sequences expired, they were incompletely processed (no sequence version
assigned), and yet they were included in our 0630 products. This problem
has also been addressed.

We regret any inconvenience that the missing sequence version numbers may
have caused for our users.

Mark Cavanaugh
GenBank
NCBI/NLM/NIH


---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca