Correction:
There is a typo in the FTP site links, the correct URL is:
ftp://ftp.ncbi.nih.gov/refseq/release/
^^^^^^
all lower case
Sorry for any inconvenience this may have caused.
-----Original Message-----
To: 'genbankb at net.bio.net'
Sent: 7/2/2003 5:03 PM
Subject: Announcing RefSeq Release 1
This announcement is being provided to the GenBank
newsgroup because of the high likelihood that GenBank
users will have interest in the RefSeq database
product.
****************************
ANNOUNCING: RefSeq Release 1
****************************
RefSeq Release 1, the first full release of all NCBI RefSeq records,
is now available by anonymous FTP at:
ftp://ftp.ncbi.nih.gov/RefSeq/release/
The NCBI RefSeq project is an ongoing effort to provide a curated,
non-redundant collection of reference sequences, representative
of the central dogma (genomes, transcripts, protein), for each major
organism.
This first release includes all of the sequence data that we have
collected at this time. Although the RefSeq collection is not yet
complete, its value as a non-redundant dataset has reached a level
that justifies providing full releases.
This full release, Release 1, incorporates genomic, transcript, and
protein data available as of June 30, 2003 and includes over
785,000 proteins and sequences from 2005 different organisms.
The release is provided in several directories as a complete dataset and
also as divided by logical groupings. The number of species represented
in each Release sub-directory, determined by counting distinct tax IDs,
is as follows:
complete 2005
fungi 27
invertebrate 80
microbial 334
mitochondrion 417
plant 30
plasmid 36
plastid 31
protozoa 39
vertebrate_mammalian 74
vertebrate_other 206
viral 1179
The total number of accessions and length (number of nucleotides
or amino acids, per type of molecule, is as follows:
Type Accessions Length
------------------------------------------
Genomic: 64729 4339114280
RNA: 211803 333757669
Protein: 785143 263588685
RefSeq Release 1 is available by anonymous FTP at:
ftp://ftp.ncbi.nih.gov/RefSeq/release/
Release notes documenting the scope and contents of the release are
provided at:
ftp://ftp.ncbi.nih.gov/RefSeq/release/release-notes/
A catalog documenting the contents of the release is available at:
ftp://ftp.ncbi.nih.gov/RefSeq/release/release-catalog/
Release statistics are available at:
ftp://ftp.ncbi.nih.gov/RefSeq/release/release-statistics/
Additional information about the RefSeq project is available at:
1. The NCBI RefSeq Web Site:
http://www.ncbi.nih.gov/RefSeq/
2. The NCBI Handbook
The Reference Sequence (RefSeq) Project.
Available from:
http://www.ncbi.nih.gov/entrez/query.fcgi?db=Books
Please send questions, comments, and suggestions concerning the RefSeq
release or the RefSeq project to:
info at ncbi.nlm.nih.gov
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
