IUBio

GbUpdate : nc0131 Install Problem

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Fri Feb 1 21:13:01 EST 2002


Greetings GenBank Users,

Due to network file system problems, the nc0131 GenBank Update
products were not installed correctly at the NCBI FTP site on
the morning of 1/31/2002 .

The following update files were affected:

	nc0131.aso.gz
	nc0131.flat.gz
	nc0131.fsa.gz
	nc0131.qscore.gz

The files were manually installed on our FTP site on the
evening of 02/01/2002, at approximately 5:40pm EST.

As a result, the nc0131 update files have appeared out-of-order,
*after* the nc0201 update files were made available (installed at
about 3:20am EST).

There is no overlap in the accession content of the nc0131 and
nc0201 updates (fortunately).

Users/software should always examine the update-dates of sequence
records for reversions. In the event that incremental files are
made available or processed out of order, a check of update-date
values can prevent an earlier version of a record from replacing
a more recent version.

Our apologies for any inconvenience that this installation 
problem may have caused.

Mark Cavanaugh
GenBank
NCBI/NLM/NIH

---



- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  





More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net