IUBio

Entrez linking broken

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Thu Sep 7 09:46:42 EST 2000


A fairly major change was made to Entrez recently.

Although extensive testing was done, it is always
difficult to simulate the effects of proxies, load
balancing, and very heavy user load.

Unfortunately, under just those conditions, a problem
was discovered with the new software. So the change
was backed out late Wednesday.

Clicking on the hit for L15449 in the results of the
BLAST search you describe now behaves properly.

If the responses from NCBI service addresses were
unclear, this could be due in part to the fact that
the cause of the problem was quite difficult to 
determine. All the details weren't known until late
yesterday....

--mark cavanaugh


> To: genbank at net.bio.net
> Date: Wed, 06 Sep 2000 17:09:32 GMT
> From: "Bradley K.Sherman" <bks at emf.emf.net>
> Subject: Re: Entrez linking broken
> 
> In article <8p4i7u$t0g$1 at mercury.hgmp.mrc.ac.uk>,
> Bradley K. Sherman  <bks at emf.emf.net> wrote:
> >
> >** 
> >** Comment from the moderator:
> >** Problems like this are best forwarded to NCBI directly,
> >** but _also_ appropriate for this newsgroup.
> >** NCBI help can be reached at: info at ncbi.nlm.nih.gov
> >** cheers,                           francis at cmmt.ubc.ca
> >**
> 
> Yes I also sent mail to one of the various addresses
> listed for help on the NCBI pages.  I would have to
> say that the response from NCBI was a bit cryptic, so
> I'm offering another pathological example here:
> 
> Do a default Basic BLAST
> <URL:http://www.ncbi.nlm.nih.gov/blast/blast.cgi?Jform=0>
> on the following sequence:
> 
>  >fakefasta created Wed Sep  6 09:48:48 PDT 2000
>  AGANGAACAAGACAAGAAGAACAAAGTACCCAAGAAAATACACAAGAAGGAAACACAAAG
>  ATTGATATTGATCCAAAAGCAATGGCGTACGAGAAAGTCAACGAGCTTAACCTTAAGGAC
>  ACAGAGCTATGTCTTGGATTACCCGGAAGAACAGAGAAGATCAAAGAAGAACAAGAGGTT
>  TCTTGCGTTATTTGTAACAACAAGCGTCTATTTGAGGAAACTCGTGATGAAGAAGAATCT
>  ACACCTCCTACCAAAACTCAAATCGTTGGTTGGCCACCAGTGAGATCTTCCCGTAAGAAC
>  AACAACAGTGTGAGCTACGTGAAAGTGAGTATGGCGGAGCTCCTTACCTTCGCAAGATCG
>  ATCTCAAGACATACAAAAACTACCCCGAGCTTCTCAAAGCGNTAGAGAATATGTTCAAAG
>  NCATGATTGGNGAATATTGNGAGAGAGAAGGATACAAAAGGATCTGGATTTGTCCCACAT
>  ACCAAGAAAAAGANGGGGACTGGATGTTGGGTGGGGA
> 
> When the results arrive, scroll down to to the best hit,
> 
>  gb|L15449.1|ATHIAA2A
> 
> And click on it to get another "Query number not found:#1"
> error message.
> 
>     --bks
> 
> 
> 
> - gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
> -
> - GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
> - GENBANKB e-mail: messages sent to genbankb at net.bio.net
> - subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
> - unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
> - GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
> - problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  
> 
> 
> 
> 


---







More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net