IUBio

Campylobacter jejuni complete genome

Tatiana Tatusov tatiana at azalea.nlm.nih.gov
Tue Feb 15 21:31:21 EST 2000


Sanger has submitted the complete sequence of Campylobacter 
jejuni to EMBL.

The complete genome has been split into 6 segments with 
primary accession numbers AL139074-9, and secondary accession number
(complete genome) AL111168. 

The files are available from 

ftp://ftp.ebi.ac.uk/pub/databases/genomes/Eubacteria/cjejuni/.


Sequence files are also available form NCBI ftp site:

ftp://ncbi.nlm.nih.gov/genbank/genomes/bacteria/Cjej/


Graphical presentation will appear in Entrez Genomes

http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/framik?db=Genome&gi=152

http://www.ncbi.nlm.nih.gov/PMGifs/Genomes/org.html


Tatiana Tatusova
---------------------
Tatiana Tatusova, PhD
National Center for Biotechnology Information
National Library of Medicine
National Institutes of Health
Bethesda, MD 20894, USA
email tatiana at ncbi.nlm.nih.gov




---



- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  







More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net