Greetings GenBank Users,
The problem that lead to incorrect sequence version numbers
and GI identifiers one week ago struck again last night,
affecting 31 records in the nc0208 GenBank update. Here are the
VERSION lines of the affected records from the flatfile version
of the update:
VERSION AC022280.1 GI:-277407540
VERSION AC013254.1 GI:-277407540
VERSION AC009746.1 GI:771338
VERSION AC009391.1 GI:-277407540
VERSION AC008368.1 GI:-277407540
VERSION AC023044.1 GI:833405
VERSION AC023039.1 GI:-277407540
VERSION AC022998.1 GI:-277407540
VERSION AC022976.1 GI:-277407540
VERSION AC022966.1 GI:332728
VERSION AC022964.1 GI:-277407540
VERSION AC022925.1 GI:-277407540
VERSION AC022901.1 GI:-277407540
VERSION AC022896.1 GI:-277407540
VERSION AC022893.1 GI:449726
VERSION AC022854.1 GI:-277407540
VERSION AC022852.1 GI:454651
VERSION AC022834.1 GI:-277407540
VERSION AC022814.1 GI:-277407540
VERSION AC022799.1 GI:397411
VERSION AC022783.1 GI:-277407540
VERSION AC022777.1 GI:-277407540
VERSION AC022764.1 GI:-277407540
VERSION AC022763.1 GI:-277407540
VERSION AC022747.1 GI:-277407540
VERSION AC022735.1 GI:-277407540
VERSION AC022733.1 GI:-277407540
VERSION AC022731.1 GI:-277407540
VERSION AC018915.1 GI:-277407540
VERSION AC022718.1 GI:-277407540
VERSION AC019348.1 GI:773305
Patched nc0208 GbUpdate files in which these 31 records have
been removed were installed on our FTP server at 8:37pm EST
on Tuesday, February 8:
ftp://ncbi.nlm.nih.gov/ncbi-asn1/daily-nc/nc0208.aso.Zftp://ncbi.nlm.nih.gov/genbank/daily-nc/nc0208.flat.Z
If the records successfully loaded into your system in spite of
the invalid GI values and the version number regression, then
we suggest that you simply wait for the next incremental GbUpdate.
These records will be included, with corrected version numbers
and GIs.
However, because the repairs to some of our software which address
this problem are still under QA, we're shutting down the GenBank
Update for one evening. The nc0209 update will not be generated.
Which means the corrected versions of the 31 records won't be
available until early Thursday morning, via the nc0210 update.
Due to their sizes, we did not patch the cumulative GbUpdate
files. The erroneous records will be fixed there as well when
the next CU rebuild completes (probably near 10:00am on Thursday
morning, after the nc0210 update has been built).
Our apologies for the inconvenience that this problem has caused.
Mark Cavanaugh
GenBank
NCBI/NLM/NIH
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
