5' and 3' ESTs

[Ari Kahn]

I'm to understand that ESTs are produced by partial sequencing of cDNA
clones from both 3' and 5' ends.  Is this correct?  If so, how can obtain
from the databases both of them?  If not, how are they produced in general?

Thanks,

Ari
mailto:kahn at inf.ethz.ch
http://cbrg.inf.ethz.ch 



- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca