Neisseria meningitidis updated

Tatiana Tatusov tatiana at azalea.nlm.nih.gov
Wed Apr 5 19:36:16 EST 2000

The annotation of the Neisseria meningitidis genome has been updated
by TIGR. The corresponding records have been updated in GenBank.

Complete geneome sequence text file can be found on NCBI ftp site

Tatiana Tatusova
Tatiana Tatusova, PhD
National Center for Biotechnology Information
National Library of Medicine
National Institutes of Health
Bethesda, MD 20894, USA
Voice: (301)435-5756
Fax: (301)480-9241
email tatiana at ncbi.nlm.nih.gov


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  

More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net