IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

[Computational-biology] GeneDoc issue

John N Calley via comp-bio%40net.bio.net (by calley_john_n from lilly.com)
Fri May 10 12:48:20 EST 2013


Tijesunimi,
   It looks like your problem may be the lines that start with ' = score'. They are not valid fasta. Having said that, there are some tricks to using GeneDoc the first time that you may be running into separate from this. I love GeneDoc and use it all the time, but it can be a bit difficult at first. If you still are having trouble, feel free to contact me directly and I'll try to help.

John

-----------------------------------------------------
John N. Calley, Ph. D.
Translational Sciences, Bioinformatics
Eli Lilly and Co.
Lilly Corporate Center
Indianapolis, IN 46285

(317) 433-3399
calley_john_n from lilly.com

-----Original Message-----
From: comp-bio-bounces from oat.bio.indiana.edu [mailto:comp-bio-bounces from oat.bio.indiana.edu] On Behalf Of comp-bio-request from oat.bio.indiana.edu
Sent: Friday, May 10, 2013 1:07 PM
To: comp-bio from magpie.bio.indiana.edu
Subject: Comp-bio Digest, Vol 96, Issue 3

Send Comp-bio mailing list submissions to
	comp-bio from net.bio.net

To subscribe or unsubscribe via the World Wide Web, visit
	http://www.bio.net/biomail/listinfo/comp-bio
or, via email, send a message with subject or body 'help' to
	comp-bio-request from net.bio.net

You can reach the person managing the list at
	comp-bio-owner from net.bio.net

When replying, please edit your Subject line so it is more specific than "Re: Contents of Comp-bio digest..."


Today's Topics:

   1. IV ECCOMAS Thematic Conference VipIMAGE	2013: LAST CALL
      (tavares from fe.up.pt)
   2. Genedoc (Tijesunimi Odebode)


----------------------------------------------------------------------

Message: 1
Date: Thu, 9 May 2013 10:27:32 -0700 (PDT)
From: "tavares from fe.up.pt" <tavares from fe.up.pt>
Subject: [Computational-biology] IV ECCOMAS Thematic Conference
	VipIMAGE	2013: LAST CALL
To: bionet-biology-computational from moderators.isc.org
Message-ID: <38150de6-0e62-4b1e-95a2-a6bcc07ef6ed from googlegroups.com>
Content-Type: text/plain; charset=windows-1252

Dear Colleague,

Attending several requests, the organizing committee has extended the submission of abstracts for the International Conference VipIMAGE 2013 - IV ECCOMAS THEMATIC CONFERENCE ON COMPUTATIONAL VISION AND MEDICAL IMAGE PROCESSING (www.fe.up.pt/~vipimage) to be held October 14-16, 2013, in Melia Madeira Mare Hotel, Madeira Island, Funchal, Portugal, to May 20th.

Possible Topics (not limited to)

? Signal and Image Processing
? Computational Vision
? Medical Imaging
? Physics of Medical Imaging
? Tracking and Analysis of Movement
? Simulation and Modeling
? Image Acquisition
? Industrial Applications
? Shape Reconstruction
? Objects Segmentation, Matching, Simulation ? Data Interpolation, Registration, Acquisition and Compression ? 3D Vision ? Virtual Reality ? Visual Inspection ? Software Development for Image Processing and Analysis ? Computer Aided Diagnosis, Surgery, Therapy, and Treatment ? Computational Bioimaging and Visualization ? Telemedicine Systems and their Applications

Invited Lecturers

? Daniel Rueckert - Imperial College London, UK ? Dimitris N. Metaxas - Rutgers University, USA ? Durval C. Costa - Champalimaud Foundation, Portugal ? James S Duncan - Yale School of Medicine, USA ? Milan Sonka - The University of Iowa, USA ? Richard Bowden - University of Surrey, UK

Thematic Sessions

Proposals to organize Thematic Session under the auspicious of VipIMAGE 2013 are welcome.
The proposals should be submitted by email to the conference co-chairs (tavares from fe.up.pt, rnatal from fe.up.pt).

Confirmed Thematic Sessions

? Imaging of Biological Flows: trends and challenges ? Trabecular Bone Characterization: New trends and challenges ? Computational Vision and Image Processing applied to Dental Medicine

Publications

? Proceedings: The proceedings book will be published by the Taylor & Francis Group (www.balkema.nl/instructions.asp) and indexed by Thomson Reuters Conference Proceedings Citation Index, IET Inspect and Elsevier Scopus.
? Springer Book: A book with 20 invited works from the ones presented in the conference will be published by Springer under the book series ?Lecture Notes in Computational Vision and Biomechanics? (www.springer.com/series/8910).
? Journal Publication: A dedicated special issue of the Taylor & Francis International Journal ?Computer Methods in Biomechanics and Biomedical Engineering: Imaging & Visualization? (www.tandfonline.com/tciv) will be published with extended versions of the best works presented in the conference.

Important dates

? Deadline for (2-4 pages) Abstracts: May 20, 2013 (LAST POSTPONED) ? Authors Notification: June 10, 2013 ? Deadline to upload Lectures and Papers: July 1, 2013


We are looking forward to see you in Funchal next October.

Kind regards,

Jo?o Manuel R. S. Tavares
Renato Natal Jorge
(conference co-chairs)

PS. For further details, please, have a look in the conference website at: www.fe.up.pt/~vipimage, or in the conference Facebook page at: www.facebook.com/pages/Vipimage/237980719665456, or join the LinkedIn conference group at: http://www.linkedin.com/groups?gid=4752820&trk=hb_side_g



------------------------------

Message: 2
Date: Fri, 10 May 2013 04:57:45 -0700 (PDT)
From: Tijesunimi Odebode <tijesunimi from yahoo.com>
Subject: [Computational-biology] Genedoc
To: "comp-bio from net.bio.net" <comp-bio from magpie.bio.indiana.edu>
Message-ID:
	<1368187065.47437.YahooMailNeo from web161505.mail.bf1.yahoo.com>
Content-Type: text/plain; charset=iso-8859-1

Good morning,

I am a graduate student and a first time user of genedoc. I tried importing a .mfa (multifasta) alignment file using genedoc, but I got an error message saying "duplicate sequence name found." How do I fix this problem? I will really appreciate any help. Thanks in advance. Here is some part of the file:

TGGATCTGCGGGAGCGTGAGCGGTTGCGCGGACAGCGCCTGCAGGTCGGCCGTGAAGTCA
AGGATGCCTTCTTGTGTTCCGGCGGCCAGGGCATCGGCGATGACCTGAGGCGGCACGTTC
GGCCACAGCCCGAACGGCGTTCGCACATCGGCGTAGCTCGTCGAGTAGCCGTAGTTCGGG
TCGCCGTAGCCCAGGTTGACGATCACC
= score = 59667 ?type = DM ?L1 = 4392353 ?L2 = 4345492 ?AL1 = 59664 ?AL2 = 59636 ?P_ID = 99.89
>379026087 AP012340:177550-178025 (+)
TGTGCCGGTGTGAGGTCCGCATACGTGGTGTGCACCGTGAGTATCCCGAATACTGCGTTG
ATATCGGACAGGACATTGAGTGGATACCGCGGGAAGTCGGCGAAACCGTCGTACTCGAGG
GTGTAGGTCGTCGTCGGATAGGGATTGTCCGGGG---TCGCCCCGTAGAACGGTAGGCCG
AGGGTGGTGACATTCAGACCGGGTATGCGCGCAAGTATCCCGCCATTGGGATTCATCTCG
TTGCCGATCAAGATGAAATTGAGCTGGCTGGGGCTGGGAGCGTTGGGACCCAGCGAGATG
AGGTGCTGCATTTCCAGGGACGCGATGACGGCGCTCTGCGAATAGCCGAACACGGTGACG
TGGTTTCCGGCGTTGATTTGCTC--CCA-AATCGCGCCGTCGAGAATCTGTAGGCCCAAC
TGCACCGAGGTTTGGAAGGGCAGGGATTTGACGCCGGTGATCGGATATAGCTCTTCGGGC
GT
>31742509 BX248333:180260-180741 (+)
TGCGCGGGCGTGAGGTCCAAATACTTGGTGTGTACGAATGTGATGCCTGCAACCGCGTTG
AGGTCGGAAATGAAGTTGAGCGGGTATCGCGAGAAGTCGGCGAACCCGTCGTACTCGAGC
GTGTAGATGGCCGTCGGATAGATCGTGTCCGAGGGCGTTGCGCCATAGAACGTCAGGTCC
AGAGTCGGAAGCGTCAGATCCGGGAACCGCGCGAGCATACCGCCATTGGGGTTCATTTCA
TTGCCGACAAGCACGAAATTGAGGTCGCTCGCCGAAGGTGCGGCCCCGCCCATCGCCGTG
AACCTCTGCATCTCCAGCGACGCGATTATGGCGCTTTGCGACCAGCCGAAAACGGTGACC
GCGTTTCCGGTGGTCGCGAGCTCTACCATGATCGCGTCGTGCAAGATGGTCAAGCCCTCT
TCCACTGACGTGTTGAGGACCAAACTTCTGACACCGGTGAGTGGGTACAACTCTTCGGGT
GT
= score = 482 ?type = M2 ?L1 = 4392353 ?L2 = 4345492 ?AL1 = 476 ?AL2 = 482 ?P_ID = 69.25
>379026087 AP012340:179382-179864 (+)
CTGCGCGGGCGTGAGGTCCAAATACTTGGTGTGTACGAATGTGATGCCTGCAACCGCGTT
GAGGTCGGAAATGAAGTTGAGCGGGTATCGCGAGAAGTCGGCGAACCCGTCGTACTCGAG
CGTGTAGATGGCCGTCGGATAGATCGTGTCCGAGGGCGTTGCGCCATAGAACGTCAGGTC
CAGAGTCGGAAGCGTCAGATCCGGGAACCGCGCGAGCATACCGCCATTGGGGTTCATTTC
ATTGCCGACAAGCACGAAATTGAGGTCGCTCGCCGAAGGTGCGGCCCCGCCCATCGCCGT
GAACCTCTGCATCTCCAGCGACGCGATTATGGCGCTTTGCGACCAGCCGAAAACGGTGAC
CGCGTTTCCGGTGGTCGCGAGCTCTACCATGATCGCGTCGTGCAAGATGGTCAAGCCCTC
TTCCACTGACGTGTTGAGGACCAAACTTCTGACACCGGTGAGTGGGTACAACTCTTCGGG
TGT
>31742509 BX248333:178426-178902 (+)
CTGTGCCGGTGTGAGGTCCGCATACGTGGTGTGCACCGTGAGTATCCCGAATACTGCGTT
GATATCGGACAGGACATTGAGTGGATACCGCGGGAAGTCGGCGAAACCGTCGTACTCGAG
GGTGTAGGTCGTCGTCGGATAGGGATTGTCCGGGG---TCGCCCCGTAGAACGGTAGGCC
GAGGGTGGTGACATTCAGACCGGGTATGCGCGCAAGTATCCCGCCATTGGGATTCATCTC
GTTGCCGATCAAGATGAAATTGAGCTGGCTGGGGCTGGGAGCGTTGGGACCCAGCGAGAT
GAGGTGCTGCATTTCCAGGGACGCGATGACGGCGCTCTGCGAATAGCCGAACACGGTGAC


Tijesunimi Odebode

------------------------------

_______________________________________________
Comp-bio mailing list
Comp-bio from net.bio.net
http://www.bio.net/biomail/listinfo/comp-bio

End of Comp-bio Digest, Vol 96, Issue 3
***************************************



More information about the Comp-bio mailing list

Send comments to us at biosci-help [At] net.bio.net