IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

[Computational-biology] Genedoc

Tijesunimi Odebode via comp-bio%40net.bio.net (by tijesunimi from yahoo.com)
Fri May 10 06:57:45 EST 2013


Good morning,

I am a graduate student and a first time user of genedoc. I tried importing a .mfa (multifasta) alignment file using genedoc, but I got an error message saying "duplicate sequence name found." How do I fix this problem? I will really appreciate any help. Thanks in advance. Here is some part of the file:

TGGATCTGCGGGAGCGTGAGCGGTTGCGCGGACAGCGCCTGCAGGTCGGCCGTGAAGTCA
AGGATGCCTTCTTGTGTTCCGGCGGCCAGGGCATCGGCGATGACCTGAGGCGGCACGTTC
GGCCACAGCCCGAACGGCGTTCGCACATCGGCGTAGCTCGTCGAGTAGCCGTAGTTCGGG
TCGCCGTAGCCCAGGTTGACGATCACC
= score = 59667  type = DM  L1 = 4392353  L2 = 4345492  AL1 = 59664  AL2 = 59636  P_ID = 99.89
>379026087 AP012340:177550-178025 (+)
TGTGCCGGTGTGAGGTCCGCATACGTGGTGTGCACCGTGAGTATCCCGAATACTGCGTTG
ATATCGGACAGGACATTGAGTGGATACCGCGGGAAGTCGGCGAAACCGTCGTACTCGAGG
GTGTAGGTCGTCGTCGGATAGGGATTGTCCGGGG---TCGCCCCGTAGAACGGTAGGCCG
AGGGTGGTGACATTCAGACCGGGTATGCGCGCAAGTATCCCGCCATTGGGATTCATCTCG
TTGCCGATCAAGATGAAATTGAGCTGGCTGGGGCTGGGAGCGTTGGGACCCAGCGAGATG
AGGTGCTGCATTTCCAGGGACGCGATGACGGCGCTCTGCGAATAGCCGAACACGGTGACG
TGGTTTCCGGCGTTGATTTGCTC--CCA-AATCGCGCCGTCGAGAATCTGTAGGCCCAAC
TGCACCGAGGTTTGGAAGGGCAGGGATTTGACGCCGGTGATCGGATATAGCTCTTCGGGC
GT
>31742509 BX248333:180260-180741 (+)
TGCGCGGGCGTGAGGTCCAAATACTTGGTGTGTACGAATGTGATGCCTGCAACCGCGTTG
AGGTCGGAAATGAAGTTGAGCGGGTATCGCGAGAAGTCGGCGAACCCGTCGTACTCGAGC
GTGTAGATGGCCGTCGGATAGATCGTGTCCGAGGGCGTTGCGCCATAGAACGTCAGGTCC
AGAGTCGGAAGCGTCAGATCCGGGAACCGCGCGAGCATACCGCCATTGGGGTTCATTTCA
TTGCCGACAAGCACGAAATTGAGGTCGCTCGCCGAAGGTGCGGCCCCGCCCATCGCCGTG
AACCTCTGCATCTCCAGCGACGCGATTATGGCGCTTTGCGACCAGCCGAAAACGGTGACC
GCGTTTCCGGTGGTCGCGAGCTCTACCATGATCGCGTCGTGCAAGATGGTCAAGCCCTCT
TCCACTGACGTGTTGAGGACCAAACTTCTGACACCGGTGAGTGGGTACAACTCTTCGGGT
GT
= score = 482  type = M2  L1 = 4392353  L2 = 4345492  AL1 = 476  AL2 = 482  P_ID = 69.25
>379026087 AP012340:179382-179864 (+)
CTGCGCGGGCGTGAGGTCCAAATACTTGGTGTGTACGAATGTGATGCCTGCAACCGCGTT
GAGGTCGGAAATGAAGTTGAGCGGGTATCGCGAGAAGTCGGCGAACCCGTCGTACTCGAG
CGTGTAGATGGCCGTCGGATAGATCGTGTCCGAGGGCGTTGCGCCATAGAACGTCAGGTC
CAGAGTCGGAAGCGTCAGATCCGGGAACCGCGCGAGCATACCGCCATTGGGGTTCATTTC
ATTGCCGACAAGCACGAAATTGAGGTCGCTCGCCGAAGGTGCGGCCCCGCCCATCGCCGT
GAACCTCTGCATCTCCAGCGACGCGATTATGGCGCTTTGCGACCAGCCGAAAACGGTGAC
CGCGTTTCCGGTGGTCGCGAGCTCTACCATGATCGCGTCGTGCAAGATGGTCAAGCCCTC
TTCCACTGACGTGTTGAGGACCAAACTTCTGACACCGGTGAGTGGGTACAACTCTTCGGG
TGT
>31742509 BX248333:178426-178902 (+)
CTGTGCCGGTGTGAGGTCCGCATACGTGGTGTGCACCGTGAGTATCCCGAATACTGCGTT
GATATCGGACAGGACATTGAGTGGATACCGCGGGAAGTCGGCGAAACCGTCGTACTCGAG
GGTGTAGGTCGTCGTCGGATAGGGATTGTCCGGGG---TCGCCCCGTAGAACGGTAGGCC
GAGGGTGGTGACATTCAGACCGGGTATGCGCGCAAGTATCCCGCCATTGGGATTCATCTC
GTTGCCGATCAAGATGAAATTGAGCTGGCTGGGGCTGGGAGCGTTGGGACCCAGCGAGAT
GAGGTGCTGCATTTCCAGGGACGCGATGACGGCGCTCTGCGAATAGCCGAACACGGTGAC


Tijesunimi Odebode


More information about the Comp-bio mailing list

Send comments to us at biosci-help [At] net.bio.net