Genotyper

[Vahe Bedian]

Hello everyone,

We are considering purchasing ABI's Genotyper software. If you have this
software and have experience with it, I would appreciate hearing your
opinions about its capabilities, usefulness, etc.

Thanks for your time.

Vahe Bedian



ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT

            University of Pennsylvania    Department of Genetics

                            DNA Sequencing Facility

 455 Clinical Research Building, 422 Curie Blvd, Philadelphia, PA 19104-6145

Vahe Bedian, Ph.D. Technical Director                      Phone: 215-573-7407
Sabine Baxter, Research Specialist                           Fax: 215-573-5892
Tasha Adams, Research Specialist        e-mail: DNASequence at mail.med.upenn.edu
Charlotte Furey, Research Specialist                 FTP: DNASEQ.MED.UPENN.EDU

ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT