IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

database cross-reference

Elisabeth Gasteiger Elisabeth.Gasteiger at isb-sib.ch
Tue Jul 9 03:59:36 EST 2002


Dear Huaichun,

> Sir, 
> for each protein sequence entry in swall, there is a database 
> cross-reference to EMBL entries (the line begining with 
> "DR EMBL;". 

Actually, this is not true for all entries in SWALL (SWISS-PROT,
TrEMBL, TrEMBL_new) - there are also entries describing sequences
that have been determined on amino acid level only.
In those cases there is no link to the nucleotide sequence database.
Example: http://us.expasy.org/cgi-bin/niceprot.pl?P29361


> My question is when there are several 
> cross-refered EMBL entries for one swissprot entry, what 
> is the difference between these entries; Do the nucleotide entries 
> have the same sequences? 
No, not necessarily.
One of the primary goals of SWISS-PROT is to be non-redundant, e.g. to
have one SWISS-PROT entry per gene, even if there are several 
sequencing reports in the DNA databases.
Some of these underlying EMBL entries may have identical sequences,
others only refer to fragments, to one or several exons, and there
may be sequencing conflicts or polymorphisms.

See the SWISS-PROT user manual, 
http://www.expasy.org/sprot/userman.html#whatis
> 
>      b) Minimal redundancy
> 
> Many sequence databases contain, for a given protein sequence, separate
> entries which correspond to different literature reports. In SWISS-PROT we try
> as much as possible to merge all these data so as to minimize the redundancy
> of the database. If conflicts exist between various sequencing reports, they are
> indicated in the feature table of the corresponding entry.
If you look at the feature  table of TAP1_HUMAN
http://us.expasy.org/cgi-bin/niceprot.pl?tAP1_HUMAN#features
you will see several variants:
FT   VARIANT     333    333       I -> V (IN TAP1*02011/PSF1B,
FT                                TAP1*0301/PSF1C, TAP1*0401 AND
TAP1*X).
FT                                /FTId=VAR_000092.
FT   VARIANT     370    370       A -> V (IN TAP1*X).
FT                                /FTId=VAR_013151.
FT   VARIANT     458    458       V -> L (IN TAP1*0401).
FT                                /FTId=VAR_013152.
FT   VARIANT     518    518       V -> I (IN TAP1*X).
FT                                /FTId=VAR_013153.
FT   VARIANT     637    637       D -> G (IN TAP1*02011/PSF1B, TAP1*0401
FT                                AND TAP1*X).
FT                                /FTId=VAR_000093.
FT   VARIANT     648    648       R -> Q (IN TAP1*0401).
FT                                /FTId=VAR_013154.
FT   VARIANT     659    659       R -> Q (IN A LUNG CANCER CELL LINE
FT                                DEFICIENT IN MHC CLASS I
PRESENTATION).
FT                                /FTId=VAR_013173.
> 
> For example, when I used SRS to search for TAP1_HUMAN in swall, I got 
> a protein sequence entry. There are 10 EMBL entries cross-refered 
> to this protein. They are: 
> DR EMBL; X66401; CAA47025.1; -. 
> DR EMBL; X57521; CAA40740.1; -. 
> DR EMBL; X57522; CAA40741.1; ALT_INIT. 
> DR EMBL; L21204; AAC12902.1; -. 
> DR EMBL; L21205; AAC12903.1; -. 
> DR EMBL; L21206; AAC12904.1; -. 
> DR EMBL; L21207; AAC12905.1; -. 
> DR EMBL; L21208; AAC12906.1; -. 
> DR EMBL; X87344; CAA60785.1; -. 
> DR EMBL; S70274; AAD14056.1; -. 
> 
> What are the same and difference among these 10 EMBL entries? 

You can use SRS (e.g. srs.ebi.ac.uk) to retrieve those 10 entries from
EMBL
Accession number: X66401|X57521|.....

and then launch clustalw to perform a multiple alignment of all 10
sequences
(see below). 
I hope this helps.

Best regards
Elisabeth Gasteiger

                    SEVMHC         
------------------------------------------------------------
                    HSMHCAPG       
------------------------------------------------------------
                    HSRING4        
GCGGCCGCTTTCGATTTCGCTTTCCCCTAAATGGCTGAGCTTCTCGCCAGCGCAGGATCA
                    HSTAP1A        
------------------------------------------------------------
                    HSTAP1B        
------------------------------------------------------------
                    HSTAP1C        
------------------------------------------------------------
                    HSTAP1D        
------------------------------------------------------------
                    HSTAP1E        
------------------------------------------------------------
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
---GATCAGGCTCTTTCTCTCTGTAAACCTGCTCCCATGGCATTCTTTTCTGCTTCAATT
                    HSMHCAPG       
------------------------------------------------------------
                    HSRING4        
GCCTGTTCCTGGGACTTTCCGAGAGCCCCGCCCTCGTTCCCTCCCCCAGCCGCCAGTAGG
                    HSTAP1A        
------------------------------------------------------------
                    HSTAP1B        
------------------------------------------------------------
                    HSTAP1C        
------------------------------------------------------------
                    HSTAP1D        
------------------------------------------------------------
                    HSTAP1E        
------------------------------------------------------------
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
CAGTCCATCCCTGACCACCCACCCAGCCACCCATGCTGGAAATCTGAGATATCTTTGACT
                    HSMHCAPG       
------------------------------------------------------------
                    HSRING4        
GGAGGACTCGGCGGTACCCGGAGCTTCAGGCCCCACCGGGGCGCGGAGAGTCCCAGACCC
                    HSTAP1A        
------------------------------------------------------------
                    HSTAP1B        
------------------------------------------------------------
                    HSTAP1C        
------------------------------------------------------------
                    HSTAP1D        
------------------------------------------------------------
                    HSTAP1E        
------------------------------------------------------------
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
CCTCCACCTTCCCACTCCCACAGCTAATCAGTAGCCAAACCCTTTAGATTCTACTTCCTA
                    HSMHCAPG       
-------------------------------TCGACGGGATCACGAGGTCAGGAGATCGA
                    HSRING4        
GGCCGGGACCGGGACGGCGTCCGAGTGCCAATGGCTAG-CTCTAGGTGTCCCGCTCCCCG
                    HSTAP1A        
------------------------------ATGGCTAG-CTCTAGGTGTCCCGCTCCCCG
                    HSTAP1B        
------------------------------ATGGCTAG-CTCTAGGTGTCCCGCTCCCCG
                    HSTAP1C        
------------------------------ATGGCTAG-CTCTAGGTGTCCCGCTCCCCG
                    HSTAP1D        
------------------------------ATGGCTAG-CTCTAGGTGTCCCGCTCCCCG
                    HSTAP1E        
------------------------------ATGGCTAG-CTCTAGGTGTCCCGCTCCCCG
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
ATTATCTTGATATTCTATCTCCTCTGCCTCCTCTAATTATGACTTAATTCAGGCTCTTAT
                    HSMHCAPG       
GA------------CCATCCTGACTACCACGGTGAA------------------------
                    HSRING4        
--------------CGGGTGCCGCTGCCTCCCCGGA----------------GCT-----
                    HSTAP1A        
--------------CGGGTGCCGCTGCCTCCCCGGA----------------GCT-----
                    HSTAP1B        
--------------CGGGTGCCGCTGCCTCCCCGGA----------------GCT-----
                    HSTAP1C        
--------------CGGGTGCCGCTGCCTCCCCGGA----------------GCT-----
                    HSTAP1D        
--------------CGGGTGCCGCTGCCTCCCCGGA----------------GCT-----
                    HSTAP1E        
--------------CGGGTGCCGCTGCCTCCCCGGA----------------GCT-----
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TATCTGTCATTTAAATTATTGCTGTATTGCTACAGGAGTGGTGTGTATATGTGCAACTGT
                    HSMHCAPG       
--ACCCCGTCTCTACTAAAAAAAATACAAAAAA---------------------------
                    HSRING4        
--TCTCTCGCATGGCTGGGGACAGTACTGCTAC---------------------------
                    HSTAP1A        
--TCTCTCGCATGGCTGGGGACAGTACTGCTAC---------------------------
                    HSTAP1B        
--TCTCTCGCATGGCTGGGGACAGTACTGCTAC---------------------------
                    HSTAP1C        
--TCTCTCGCATGGCTGGGGACAGTACTGCTAC---------------------------
                    HSTAP1D        
--TCTCTCGCATGGCTGGGGACAGTACTGCTAC---------------------------
                    HSTAP1E        
--TCTCTCGCATGGCTGGGGACAGTACTGCTAC---------------------------
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TCATCTTGGTATGCTATAGACTCTTGCCCAGCAGTTTTGCCTCAATTCTTTAAAAGCTCC
                    HSMHCAPG       
----------------------CTAGCCAGG---------CATGGTGGC-----------
                    HSRING4        
--------------------TTCTCGCCGA----------CTGGGTGCT------GCTCC
                    HSTAP1A        
--------------------TTCTCGCCGA----------CTGGGTGCT------GCTCC
                    HSTAP1B        
--------------------TTCTCGCCGA----------CTGGGTGCT------GCTCC
                    HSTAP1C        
--------------------TTCTCGCCGA----------CTGGGTGCT------GCTCC
                    HSTAP1D        
--------------------TTCTCGCCGA----------CTGGGTGCT------GCTCC
                    HSTAP1E        
--------------------TTCTCGCCGA----------CTGGGTGCT------GCTCC
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
AGTTCATTGTTTGAAATATCAATCAGAACATTTTTTCCAAAATGCTAAAATGATTGTCAT
                    HSMHCAPG       
-GGGCGCC--------TGTAGTTCCAGCTACT----------------------------
                    HSRING4        
GGACCGC----------GCTGCCCCGCATATTCTCCCTG---------------------
                    HSTAP1A        
GGACCGC----------GCTGCCCCGCATATTCTCCCTG---------------------
                    HSTAP1B        
GGACCGC----------GCTGCCCCGCATATTCTCCCTG---------------------
                    HSTAP1C        
GGACCGC----------GCTGCCCCGCATATTCTCCCTG---------------------
                    HSTAP1D        
GGACCGC----------GCTGCCCCGCATATTCTCCCTG---------------------
                    HSTAP1E        
GGACCGC----------GCTGCCCCGCATATTCTCCCTG---------------------
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TCCCCAGTTTTAATATCTCTATCATCTGCTAAGTAAAAGCAAGCTCCTCCTTGTGGCGTA
                    HSMHCAPG       
---CGGGAGGCTGAGGAGGGAGAA--TGGCGTGAA------------CCCGGGAGGCGGA
                    HSRING4        
---CTGGTGCCCACCGCGCTGCCA-CTGCTCCGGG------------TCTGGGCGGTGGG
                    HSTAP1A        
---CTGGTGCCCACCGCGCTGCCA-CTGCTCCGGG------------TCTGGGCGGTGGG
                    HSTAP1B        
---CTGGTGCCCACCGCGCTGCCA-CTGCTCCGGG------------TCTGGGCGGTGGG
                    HSTAP1C        
---CTGGTGCCCACCGCGCTGCCA-CTGCTCCGGG------------TCTGGGCGGTGGG
                    HSTAP1D        
---CTGGTGCCCACCGCGCTGCCA-CTGCTCCGGG------------TCTGGGCGGTGGG
                    HSTAP1E        
---CTGGTGCCCACCGCGCTGCCA-CTGCTCCGGG------------TCTGGGCGGTGGG
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
GCAGGGCCCACGTGATCTGGCCCTTGCCCGAATTTGTAGCTTATCACAACATCCTTCTAC
                    HSMHCAPG       
GCTT-GCAG--------TGAGCCGAGATTGTGCCACTGCACTCCAGCCTGGGCGACAGAG
                    HSRING4        
CCTGAGCCG-------CTGGGCCGTGCTCTGGCTGGGGGCCTG---CGGGGTCCTCAGGG
                    HSTAP1A        
CCTGAGCCG-------CTGGGCCGTGCTCTGGCTGGGGGCCTG---CGGGGTCCTCAGGG
                    HSTAP1B        
CCTGAGCCG-------CTGGGCCGTGCTCTGGCTGGGGGCCTG---CGGGGTCCTCAGGG
                    HSTAP1C        
CCTGAGCCG-------CTGGGCCGTGCTCTGGCTGGGGGCCTG---CGGGGTCCTCAGGG
                    HSTAP1D        
CCTGAGCCG-------CTGGGCCGTGCTCTGGCTGGGGGCCTG---CGGGGTCCTCAGGG
                    HSTAP1E        
CCTGAGCCG-------CTGGGCCGTGCTCTGGCTGGGGGCCTG---CGGGGTCCTCAGGG
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
CCCCCATTACCTCCTATTATACAGGAACACCCAAGCGACCTTCACAACATTCATATCAAC
                    HSMHCAPG       
CGAGACTCCGTCTCAAAAAAAAAAAAAAAA------------------------------
                    HSRING4        
CAACGGTTGGCTCC--------AAGAGCG-------------------------------
                    HSTAP1A        
CAACGGTTGGCTCC--------AAGAGCG-------------------------------
                    HSTAP1B        
CAACGGTTGGCTCC--------AAGAGCG-------------------------------
                    HSTAP1C        
CAACGGTTGGCTCC--------AAGAGCG-------------------------------
                    HSTAP1D        
CAACGGTTGGCTCC--------AAGAGCG-------------------------------
                    HSTAP1E        
CAACGGTTGGCTCC--------AAGAGCG-------------------------------
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TAGTACACAGGGTCTCCAAAGAGGACCTCTGGATGCCTGTGATCTTTGTACTTCTGC-CT
                    HSMHCAPG       
-AAAAAAAAAAAAAAAAAAAAAAAGA----AAAGGATTGTAAG--AGTTACTGTTACATT
                    HSRING4        
-AAAACGCAGG-TGCCCAGGGCTGGC---TGGCTGCTTTGAAGCCATTAGCTGCGGCACT
                    HSTAP1A        
-AAAACGCAGG-TGCCCAGGGCTGGC---TGGCTGCTTTGAAGCCATTAGCTGCGGCACT
                    HSTAP1B        
-AAAACGCAGG-TGCCCAGGGCTGGC---TGGCTGCTTTGAAGCCATTAGCTGCGGCACT
                    HSTAP1C        
-AAAACGCAGG-TGCCCAGGGCTGGC---TGGCTGCTTTGAAGCCATTAGCTGCGGCACT
                    HSTAP1D        
-AAAACGCAGG-TGCCCAGGGCTGGC---TGGCTGCTTTGAAGCCATTAGCTGCGGCACT
                    HSTAP1E        
-AAAACGCAGG-TGCCCAGGGCTGGC---TGGCTGCTTTGAAGCCATTAGCTGCGGCACT
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
ACCCTTTGCCCTGGCGTGTTTTTCTCTTCCTTCATGTTCTGCTGGCCAAATTGTTTTTCC
                    HSMHCAPG       
---TTCTGGCCTAC-------TACCTT---------------------------------
                    HSRING4        
GGGCTTGGCCCTGCCGGGACTTGCCTT---------------------------------
                    HSTAP1A        
GGGCTTGGCCCTGCCGGGACTTGCCTT---------------------------------
                    HSTAP1B        
GGGCTTGGCCCTGCCGGGACTTGCCTT---------------------------------
                    HSTAP1C        
GGGCTTGGCCCTGCCGGGACTTGCCTT---------------------------------
                    HSTAP1D        
GGGCTTGGCCCTGCCGGGACTTGCCTT---------------------------------
                    HSTAP1E        
GGGCTTGGCCCTGCCGGGACTTGCCTT---------------------------------
                    HSY3           
------------------------------------------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TTCAAGTCTTAGGAGCCTGCCTGATTATGTTCCTCCTATTCCGCATCCTCATAAAATTAC
                    HSMHCAPG       
---------TAAAA----TTCCTGTTGCATTTCTTTGTATTTACAA--------------
                    HSRING4        
-----GTTCCGAGAGCTGATCTCATGGGGAGCCCCCGGGTCCGC----------------
                    HSTAP1A        
-----GTTCCGAGAGCTGATCTCATGGGGAGCCCCCGGGTCCGC----------------
                    HSTAP1B        
-----GTTCCGAGAGCTGATCTCATGGGGAGCCCCCGGGTCCGC----------------
                    HSTAP1C        
-----GTTCCGAGAGCTGATCTCATGGGGAGCCCCCGGGTCCGC----------------
                    HSTAP1D        
-----GTTCCGAGAGCTGATCTCATGGGGAGCCCCCGGGTCCGC----------------
                    HSTAP1E        
-----GTTCCGAGAGCTGATCTCATGGGGAGCCCCCGGGTCCGC----------------
                    HSY3           
------------------------------------GGGTCCGC----------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TGCGACTTCCAAAACACTTGGCACATTCTTATTTGAATACATTACATTGTTGTGTAATTA
                    HSMHCAPG       
----------------------------------GGAAA---------------------
                    HSRING4        
----------------------------------GGATA---------------------
                    HSTAP1A        
----------------------------------GGATA---------------------
                    HSTAP1B        
----------------------------------GGATA---------------------
                    HSTAP1C        
----------------------------------GGATA---------------------
                    HSTAP1D        
----------------------------------GGATA---------------------
                    HSTAP1E        
----------------------------------GGATA---------------------
                    HSY3           
----------------------------------GGATA---------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TCCCTTGGCCCCCTCCCCCAGCACTAGACTCTAAGCTCTTTGAAGGCAGACTATGCCTAT
                    HSMHCAPG       
--------------------AGACTGAACT--------------------TT--------
                    HSRING4        
--------------------GCACCAGGCT-------------------ACT--------
                    HSTAP1A        
--------------------GCACCAGGCT-------------------ACT--------
                    HSTAP1B        
--------------------GCACCAGGCT-------------------ACT--------
                    HSTAP1C        
--------------------GCACCAGGCT-------------------ACT--------
                    HSTAP1D        
--------------------GCACCAGGCT-------------------ACT--------
                    HSTAP1E        
--------------------GCACCAGGCT-------------------ACT--------
                    HSY3           
--------------------GCACCAGGCT-------------------ACT--------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TCATCTTTGTATTTCTAGCCCTGGGCCCAACACCCAGAATTTCTTGTATTTTCAATATAT
                    HSMHCAPG       
------------------TTCTCATCAAAACTAGCT-------TTTTTCTCACAGGTTAA
                    HSRING4        
-----------------GCACTGGGGAAGTCACCCT--ACCGCCTTCGTTGTCAGT-TAT
                    HSTAP1A        
-----------------GCACTGGGGAAGTCACCCT--ACCGCCTTCGTTGTCAGT-TAT
                    HSTAP1B        
-----------------GCACTGGGGAAGTCACCCT--ACCGCCTTCGTTGTCAGT-TAT
                    HSTAP1C        
-----------------GCACTGGGGAAGTCACCCT--ACCGCCTTCGTTGTCAGT-TAT
                    HSTAP1D        
-----------------GCACTGGGGAAGTCACCCT--ACCGCCTTCGTTGTCAGT-TAT
                    HSTAP1E        
-----------------GCACTGGGGAAGTCACCCT--ACCGCCTTCGTTGTCAGT-TAT
                    HSY3           
-----------------GCACTGGGGAAGTCACCCT--ACCGCCTTCGTTGTCAGT-TAT
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
GTCTGCCAAATGAATTAGAGCTAATGCCTGAAGGAGAATAAGTTTTTTTGAGAAAGAGGA
                    HSMHCAPG       
ACTT-------------GCACCAATGTCTGC-----------------------------
                    HSRING4        
GC--------------AGCGGCACTGCCCGCAGCAG------------------------
                    HSTAP1A        
GC--------------AGCGGCACTGCCCGCAGCAG------------------------
                    HSTAP1B        
GC--------------AGCGGCACTGCCCGCAGCAG------------------------
                    HSTAP1C        
GC--------------AGCGGCACTGCCCGCAGCAG------------------------
                    HSTAP1D        
GC--------------AGCGGCACTGCCCGCAGCAG------------------------
                    HSTAP1E        
GC--------------AGCGGCACTGCCCGCAGCAG------------------------
                    HSY3           
GC--------------AGCGGCACTGCCCGCAGCAG------------------------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
AGAGCCAGGAGGGAGGAGAAGGCAGGGTCCGAAGAGCCCTGGGGGTTTA-CTTGGGGAAG
                    HSMHCAPG       
------------------------------------TCTTTTTTTTTAATGTTTTTGGTA
                    HSRING4        
------------------------------------CCCTGTGGCACAA-ACTCGGGAGC
                    HSTAP1A        
------------------------------------CCCTGTGGCACAA-ACTCGGGAGC
                    HSTAP1B        
------------------------------------CCCTGTGGCACAA-ACTCGGGAGC
                    HSTAP1C        
------------------------------------CCCTGTGGCACAA-ACTCGGGAGC
                    HSTAP1D        
------------------------------------CCCTGTGGCACAA-ACTCGGGAGC
                    HSTAP1E        
------------------------------------CCCTGTGGCACAA-ACTCGGGAGC
                    HSY3           
------------------------------------CCCTGTGGCACAA-ACTCGGGAGC
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
ATGCGGTTCCCCATTGCAGCATTCTGCCAGGAGGTGGCACTGCTCTGAAGAGCCAGCTGG
                    HSMHCAPG       
CTCTGGGCAGACTTCAG-----TTTTTTAAAAAA-----------TAAAGATTCTA-ATG
                    HSRING4        
CTCTGGGTGCCCGGCG---------GTCAGGGCG-------GCTCTGGAAACCCTGTGCG
                    HSTAP1A        
CTCTGGGTGCCCGGCG---------GTCAGGGCG-------GCTCTGGAAACCCTGTGCG
                    HSTAP1B        
CTCTGGGTGCCCGGCG---------GTCAGGGCG-------GCTCTGGAAACCCTGTGCG
                    HSTAP1C        
CTCTGGGTGCCCGGCG---------GTCAGGGCG-------GCTCTGGAAACCCTGTGCG
                    HSTAP1D        
CTCTGGGTGCCCGGCG---------GTCAGGGCG-------GCTCTGGAAACCCTGTGCG
                    HSTAP1E        
CTCTGGGTGCCCGGCG---------GTCAGGGCG-------GCTCTGGAAACCCTGTGCG
                    HSY3           
CTCTGGGTGCCCGGCG---------GTCAGGGCG-------GCTCTGGAAACCCTGTGCG
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
TCG-CTTACAGACTGAGGCTGACAGCTTGAAACCAAAGAGGGAACTCCACCAGGAAGCAA
                    HSMHCAPG       
CAGCTATCTTGGCAT------------TCCCTTTAAATAC------CTGTC---------
                    HSRING4        
TCGGCTTCTAGGCTG----------CCTGGGCTCGGAGACG---CGCCGCC---------
                    HSTAP1A        
TCGGCTTCTAGGCTG----------CCTGGGCTCGGAGACG---CGCCGCC---------
                    HSTAP1B        
TCGGCTTCTAGGCTG----------CCTGGGCTCGGAGACG---CGCCGCC---------
                    HSTAP1C        
TCGGCTTCTAGGCTG----------CCTGGGCTCGGAGACG---CGCCGCC---------
                    HSTAP1D        
TCGGCTTCTAGGCTG----------CCTGGGCTCGGAGACG---CGCCGCC---------
                    HSTAP1E        
TCGGCTTCTAGGCTG----------CCTGGGCTCGGAGACG---CGCCGCC---------
                    HSY3           
TCGGCTTCTAGGCTG----------CCTGGGCTCGGAGACG---CGCCGCC---------
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
CATTCCTCCACTGGGCTTCCCAGCCCAGTTACATGCCATACTCTGCCCTGGTCAAACAGC
                    HSMHCAPG       
------TTAAC-----CTCCTACTTTTATT-----TCCTACTCCTTTCCACACACATGCA
                    HSRING4        
-----TCTCGCTG---TTCCTGGTCCTGGTG---GTCCTCTCCTCTCTTGGGGAGATGGC
                    HSTAP1A        
-----TCTCGCTG---TTCCTGGTCCTGGTG---GTCCTCTCCTCTCTTGGGGAGATGGC
                    HSTAP1B        
-----TCTCGCTG---TTCCTGGTCCTGGTG---GTCCTCTCCTCTCTTGGGGAGATGGC
                    HSTAP1C        
-----TCTCGCTG---TTCCTGGTCCTGGTG---GTCCTCTCCTCTCTTGGGGAGATGGC
                    HSTAP1D        
-----TCTCGCTG---TTCCTGGTCCTGGTG---GTCCTCTCCTCTCTTGGGGAGATGGC
                    HSTAP1E        
-----TCTCGCTG---TTCCTGGTCCTGGTG---GTCCTCTCCTCTCTTGGGGAGATGGC
                    HSY3           
-----TCTCGCTG---TTCCTGGTCCTGGTG---GTCCTCTCCTCTCTTGGGGAGATGGC
                    S70274         
------------------------------------------------------------
                                                                                                

                    HSEVMHC        
CAAGTCTTCAGGAGGTTACTGGCCCCAGGCGTCTCCCCAGTGACTGATGATGTTAAACCC
                    HSMHCAPG     
-- 
-----------------------------------------------------------------
Elisabeth Gasteiger
Swiss Institute of Bioinformatics
CMU - 1, rue Michel Servet                Tel. (+41 22) 702 58 75
CH - 1211 Geneva 4 Switzerland            Fax  (+41 22) 702 58 58
Elisabeth.Gasteiger at isb-sib.ch            http://www.expasy.org/ 
-----------------------------------------------------------------
---





More information about the Bio-srs mailing list

Send comments to us at biosci-help [At] net.bio.net