Howdy,
I've recently started using standalone BLAST, but I've found that when
the BLAST report is made, the program has replaced the Sequence Names
with numbers. Is there a flag or something to tell it not to do this?
Or, is there a simple way to match up the numbers with the sequences?
It seems they aren't just in order as they appear in the one-line
descriptions where the scores appear.
Here is an example:
QUERY 201 ctgggtgcaatcttgccccaaccccatgactgtgttctggtccaagatggcacagagcatg
320
4 1 .............................................................
120
7 1 ......t.......................c..c.................g.........
120
5 1 .............................................................
120
Where 4, 7 and 5 used to be sequence names, but are not neccesarily
the 4th, 5th and 7th sequences in the one-line descriptions. I don't
know what other info you might need to know what's going on, but I'm
running this with the "-m 3" flag to get flat, master-slave, show
identities.
Thanks in advance,
Rob
---
