IUBio

Read and View (Java) ABI trace file, analyze Error positions and polymorphism

Chris Boyd chrisb at hgu.mrc.ac.uk
Mon May 10 02:00:00 EST 1999


Victor Solovyev (solovyev at sanger.ac.uk) wrote:
:  We installed ABIQ - Read and View ABI trace file and potential
:                      Error positions

:  ABIQ Program is prepared to analyze ABi trace files and calculate
: error probability for each base using a new version of the approach
: described in (Lawrence,Solovyev,1994).
:      We plan to develop these tools further to use in sequence
:       EDITING/ASSEMBLING and study of HUMAN POLYMORPHISM.

: If we observe different bases in several reads of some locus and
: these bases have very small probability of errors, than we have a
: good candidate of polymorphic site.

: The program compute the PROBABILITY OF 3 TYPES OF BASE CALLING ERRORS
: (Insertion - Overcall; deletion - Undercall and substitution - Miscall).

(snip)

:  The sequence and probabilitoes of errors in 0-9 scale corresponding (0 -
: 100%).

It sounds very useful, but it would be a lot easier to spot the
non-zero probabilities if the program used "." instead of "0" for 0
probability.

For example:

: Example of output of the program:

: A01U0005            " View ABI traces and Quality data " (Java viewer button)
(snip)
:                    360       370       380       390       400
:             TAACCCAAACAGTGATCCTGGGGCTCCATTCCAGACCCAACTTAATCAGT
:  P over     00000300000000000000000000000000000001000000000000
:  P under    00020000000000000010000000000000000000000000000000
:  P mis      00100400000000000000000000000000000002000000000000
:                    410       420       430       440       450
:             ATTTCTGGAGGTTGGACACTGACGGCTGTTATTTTTCAAAGGCATCCCAG
:  P over     00000000000000000000000010000000000000000100000100
:  P under    00002100011200000000011000000001000011000000020000
:  P mis      00000001010000000000010000000000040000000100010200

:             GGTGGA
:  P over     000000
:  P under    000000
:  P mis      010000

would become:

                    360       370       380       390       4.. 
             TAACCCAAACAGTGATCCTGGGGCTCCATTCCAGACCCAACTTAATCAGT 
  P over     .....3...............................1............ 
  P under    ...2..............1............................... 
  P mis      ..1..4...............................2............ 
                    410       420       430       440       450 
             ATTTCTGGAGGTTGGACACTGACGGCTGTTATTTTTCAAAGGCATCCCAG 
  P over     ........................1................1.....1.. 
  P under    ....21...112.........11........1....11.......2.... 
  P mis      .......1.1...........1...........4.......1...1.2.. 

             GGTGGA 
  P over     ...... 
  P under    ...... 
  P mis      .1.... 

Best wishes,
-- 
Chris Boyd                      | from (but not \  MRC Human Genetics Unit
Christopher.Boyd at hgu.mrc.ac.uk  | on behalf of) /      Crewe Rd, Edinburgh
http://www.hgu.mrc.ac.uk/Users/Christopher.Boyd          EH4 2XU, SCOTLAND




More information about the Bio-soft mailing list

Send comments to us at biosci-help [At] net.bio.net