Dear Sequin users,
We have recently released a new version of Sequin, the sequence
submission/editing tool from NCBI, for all platforms except Linux
and SunOS. These versions will be available shortly.
The current version of Sequin is now 2.45
Please refer to the Sequin home page at:
http://www.ncbi.nlm.nih.gov/Sequin/
for the latest developments, new questions in the Frequently Asked
Questions section, a more detailed view of the Sequin Revision History,
and the most recent version of the help documentation.
A new version of the Sequin Quick Guide is available at:
http://www.ncbi.nlm.nih.gov/Sequin/QuickGuide/sequin.html
Major changes for Sequin version 2.45
-----------------------------------------
Summary of new features and changes:
1. Easier sequence annotations
2. New PowerBLAST features
3. Replacing or updating your sequence
4. Contact information for future submissions
5. Formatting segmented population/phylogenetic sets
6. Creating automatic definition lines
7. Encoding new information in definition line
8. Direct submission information
9. Minor changes
1. Easier sequence annotations
You can now use the Sequence Editor Feature menu, as well as the
main Sequin Annotate menu, to annotate features on the sequence.
The features listed are identical, and the instructions for adding
them are the same, with one exception. If you annotate them in the
Annotate menu, you must provide the nucleotide sequence location of
the feature. However, if you add features from the Sequence
Editor, you do not need to enter the nucleotide coordinates
manually. Simply highlight the sequence which the feature covers,
and the location of the sequence will be automatically entered in
the feature location box.
2. New PowerBLAST features
PowerBLAST capabilities have been enhanced. When you do a
PowerBLAST from within Sequin, you can limit a search either for or
against an organism or taxonomic group. Under Organism Filter,
click on "Restrict to" to limit your search to a particular
organism. Or, conversely, click on "Filter against" to search
against all organisms except one. Type the scientific name of the
organism (e.g., Homo Sapiens) or taxonomic group (e.g., Mammalia)
in the "Name" box. After you do a PowerBLAST search, additional
controls will be added to the bottom of the record viewer window.
These controls allow you to retrieve the PowerBLAST hits from
Entrez, and then look for Entrez neighbors. Use the alignment
pop-up to select the type of alignment (search) that was performed.
If multiple blast search types were run in one PowerBLAST search,
this allows you to get one type at a time. Then click on the
Retrieve button to retrieve the records in a document summary
window, where you can view Medline, Protein, Nucleotide, Structure,
and Genome neighbors of the sequence(s). Click on the Refine button
to open a query refinement window in which you can further refine
the PowerBLAST hits by selecting other Entrez terms, such as Author
name to view sequences belonging to a specific author.
3. Replacing or updating your sequence
We had previously explained that you can now replace or merge the
sequence in the record with a new sequence without going into the
Sequence Editor. This option is available in the Update Sequence
submenu of the main Sequin Edit menu. In addition to being able import
a sequence in FASTA format (Read FASTA File), import a sequence record
in ASN.1 format (Read Sequence Record), or download a sequence record
from Entrez (Download Accession), you can now import a sequence from a
Sequin PowerBLAST alignment (Selected Alignment). Note that in all
cases, both the target and the imported sequence must be nucleotide
sequences. The alignment between your original sequence and the
imported sequence can be viewed in a separate window. You can then
choose to merge the 5' or 3' end of the imported sequence with the
target sequence in the record, or replace the target sequence with the
imported sequence. The features on the imported sequence will be
automatically copied to the original sequence. You can also choose only
to propagate features from the imported sequence record to the target.
4. Contact information for future submissions
The contact, authors, and affiliation information you provide on
the Submitting Authors form can now be saved as a block and used
for subsequent submissions. For your first Sequin submission, fill
in the requested information. Then, in the record viewer, click on
"Edit Submitter Info" under the Edit menu, and then on Export
Submitter Info under the File menu in the resulting Submission
Instructions form. For subsequent Sequin submissions, click on
Import Submitter Info on the first page of the Submitting Authors
form. You must still fill in the manuscript title on the this
page, though.
5. Formatting segmented population/phylogenetic sets
Sequin can now read segmented sets of sequences which are parts of
phylogenetic, population, or mutation studies. A segmented set is a
colllection of non-overlapping sequences which cover a specified
genetic region, such as a set of exons along with fragments of flanking
introns. The sequences must be in FASTA or FASTA+GAP format. Each
segment should have its own sequence identifier (the term immediately
following the ">", but organism name and source modifiers should only
be indicated for the first segment from each sequence. Square brackets
are used to delimit the members of a set. For example:
[
>bioseq1part1 [org=Mus musculus] [strain=BALB/c]
CAGATGGCTCC
>bioseq1part2
ATAATGACAGCTTCATAATGGCAGTGGGTGAGCCCCTGGTGCACATCAG
]
[
>bioseq2part1 [org=Rattus norvegicus] [strain=Sprague-Dawley]
CAGTCGGCTCC
>bioseq2part2
ATAATGATGTCTTCATAATGGCAGAAAGTGAGCCCCTGGTGCACATCAG
]
6. Creating automatic definition lines
Sequin can now create definition lines (sequence titles)
automatically based on information provided in the record. This
option works for single sequences as well as sets of sequences, and
can handle complex annotations with multiple features. The
definition lines will follow standard GenBank conventions. Use the
function "Generate Definition Line" under the Sequin Annotate
menu.
7. Encoding new information in definition line
If you are submitting the sequence for an organism which is not
present in the NCBI taxonomy database, you can indicate the lineage
of the organism on the first line (definition line) of your
FASTA-formatted nucleotide sequence. Use the modifier
[lineage=lineage] on the line where other modifiers are indicated.
For example,
>dna1 [org=Neworganism] [strain=A] [lineage=Newlineage]
GGGGGGGGGGAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTCCCCCCCCCCCCCGGGGGGGGGGG
AAAAAAATTTTTTTTTTTTTCCCCCCCCCCCCCC
For information about the organisms presently in GenBank, see the
NCBI taxonomy browser at http://www.ncbi.nlm.nih.gov/Taxonomy/
Additional source information can also be encoded directly in the
definition line. You can now indicate
[location={genomic,chloroplast,kinetoplast,mitochondrion,macronuclear,
extrachromosomal,plasmid,transposon,insertion sequence,cyanelle,proviral,
virion}] and [molecule={dna,rna}]. In each case you can pick one item from
the list in {}, so a sample definition line could be:
>dna1 [org=Homo sapiens] [location=genomic] [molecule=dna]
8. Direct submission information
The DIRECT SUBMISSION reference for your new submission will now
appear as it will once the record is released to the public. In
the past, this information was stored by Sequin, but not
displayed. This citation lists the authors who should recieve
scientific credit for the sequence, and may have as many authors as
you see fit. It should have, at the very least, one author.
Author names are initially entered on the Submitting Authors form.
You can modify the list by double clicking on the reference.
9. Minor changes
Reference publication types now include Proceedings (meetings) and
Proceedings Chapter (meeting abstracts).
When you highlight a range of sequence in the Sequence Editor, the
selected sequence is shown as a box in the Graphic view of the
record.
An option called "Select Target" was added to the Sequin Search
menu. This option changes the sequence which is selected in the
Target Sequence pop-up.
Please do not hesitate to let us know (info at ncbi.nlm.nih.gov)
if you have any questions or comments.
francis, for the sequin development team.
--
| B.F. Francis Ouellette
| GenBank Coordinator
||francis at ncbi.nlm.nih.gov
