For the work I have been doing on the bacteriophage T4 genome
I have found that an editor for sequence work would be useful.
I have setup an example at the bottom of this message and
I will explain the various parts. I would like a work space of unlimited
(something wider than 10K bases) width and 25 to 40 lines in
length. The work space would be divided into two major areas
separated by some type of ruler. The top space would allow up to
15 sets of sequences and their names in brackets to be entered and aligned as
shown. Then a consensus sequence could be entered above the
ruler. Below the ruler, the consensus sequence would be translated
to the corresponding amino acid sequence. Preferably this
translation would be "live", changing with any change in the
consensus sequence above the ruler. As far as output options go,
I am not very optimistic, but some type of sideways printing to an
Epson emulated printer would be adequate. Chopping up the width
into 50-70 character wide chunks would be tolerable, with a couple
of blank lines between chunks. Obviously, I have outlined an
optimum editor. I am willing to look at sub-versions of this
scheme. And anything that exceeds these specs. This program will
preferably run under MS-Dos although other applications may yield
useful source code.
[~ma26b] GCTCTGTTCCGTAGACAATTAAAGCAAATTTTGTC [~ma26b]
[~ma13a] GCTCTGTTCCGTAGACAATTAAAGCAAATTTTGTC [~ma13a]
[~ma33a] AAAGCAAATTTTGTCTACTGCTAGTCGAT... [~ma33a]
[mt1a] GCTCTGTTCCGTAGACAATTAA [mt1a] [~p50_0-] GTCGAT... [~p50_0-]
[~mt3a] TTCCGTAGACAATTAAAGCAAATTTTGTCTACTGCTAGTCGA [~mt3a]
GCTCTGTTCCGTAGACAATTAAAGCAAATTTTGTCTACTGCTAGTCGAT...
---------+---------+---------+---------+---------+
1 10 20 30 40 50
AlaLeuPheArgArgGlnLeuLysGlnIleLeuSerThrAlaSerArg
LeuCysSerValAspAsnTERSerLysPheCysLeuLeuLeuValAsp
SerValProTERThrIleLysAlaAsnPheValTyrCysTERSer
Shane Peterson - Evergreen State College T4 lab
reply to t4phage at u.washington.edu
