Does anyone have any information on the program GENEFINDER.
This program was referred to in a paper in Nature last month
in which a number of likely genes were identified from their
genomic sequence. Unfortunately, the paper had very little
to say about the program itself, how it worked, what methods
it used, etc. Is this program specific for _C. elegans_?
How does it perform compared to GeneID, GRAIL and GeneModeler?
Any information or leads would be appreciated.
I am referring to the following paper:
J. Sulston _et al._ (1992) The _C. elegans_ genome sequencing
project: a beginning. Nature 356: 37-41.
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder
Department of MCD Biology ...making feet for childrens' shoes.
University of Colorado, Boulder
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------
