Hi Ying,
I see you asked this question on the ACEDB newsgroup a few days ago. Sorry
we've been slow to answer.
Your file appears to be an output from CAP3. The CAP3 ace format is
unrelated to the ACEDB ace format. It's unfortunate that they have
the same filename suffix.
The basic format for an ACEDB ace file is:
To add an object to the database, first state its class and name
(e.g. Journal Cell) on a single line in an Ace file.
Data can be attached to this object on immediately subsequent lines. The data
must be prefixed with suitable tags, such as Author, Journal, Volume and Page
in the case of Paper objects. An object's potential tags are listed in the
model for the class of objects to which that object belongs.
-- from "A Guide to Models and Ace Files",
http://genome.cornell.edu/acedoc/models_guide.html
More details are available in this document.
Here's an example of the ace format for a Contig entry in GrainGenes:
Sequence : "Contig5002"
DNA Contig5002
DNA_homol BE443570 Phrap 587 1 587 1 587
DNA_homol BE446512 Phrap 200 1 200 1 200
DNA_homol BE444107 Phrap 384 15 393 6 384
DNA : Contig5002
ACAAGCCAGTGGTAAACAGTGTGGTGTTGTAAGTCATGTACTAGCAGGTG
TGTTTGTGGATCGAAGGGTACGTGCGTATACGTGCTATCCCTCGGTCGTG
TCGAATAAACAGTGCCCAAAGCGCACCCGTGTACTAGCTAAATGCTATTA
AATTTCTATATGGAATAATAAGTTATAAGAGCAAAAAAAAAAAAAAAAAA
AAACTCGAGGGCTCACCCATGGCACAAGGTTTTTCAGAAAAAGCTTCCAC
CTGAAGCAATGGACCTTGTCAGCAGGTTTCTCCAATACTCGCCAGATCTT
CGGTGCACTGCTATGGAAGCCTGCATGCACCCGTTCTTTGATGAGTTGAG
AGATCCAAACACCCGTCTACCTAACGGTCGCCCTCTTCCTCCCCTCTTCA
ACTTCAGATCTCAAGAGCTAAACGGTATACCTCCGGAAGTCGTCGAGCGC
CTGGTTCCGGAGCATGCGAGAAAGCAGAACCTGTTCATGGCGCTCCGCAC
CTAGTTTTCGCATGTCCTCTCCGTGTTTTTTCGCGTTGTTTGGTGCCTGG
ACTCTGGAGGGAAGCTTGTAAATTGAGCTGTAGCTTT
I hope this helps.
- Dave
> From teo_yinghui at yahoo.com Sun Jan 27 02:46:40 2002
> Subject: Loading ace file into AceDB -help!
> To: acedbfaq at s27w007.pswfs.gov> Cc: matthews at greengenes.cit.cornell.edu>> Hi
> I have encountered some problems while trying to load
> new database into AceDB. Below is a section of an ace
> file that I would like to load into AceDB. This is
> part of our academic work at National University of
> Singapore. We are trying to create a database for the
> DNA of dust mites.
> While trying to load these data, I get error messages,
> eg. Error, general parse error, near line 1 while
> parsing AS200 1039, error was : Unrecognised class
> AS
>> As I go on to read the next line, the same error
> messages appear, indicating unrecognized class CO,
> class BQ and so on. I am not sure what could be done
> to rectify this. Would really appreciate if you could
> advise me on where the problem lies. Should classes be
> defined at the beginning of the file?
> Hope to hear from you soonthank you.
>> Ying
>>> Section of our ace file:
>> AS 200 1039
>> CO Contig1 625 1 1 U
> ctagaactagtggatcccccgggctgcaggaattccggacaaattgcaat
> tccggcacaaggaatgattgaatttcgagatgctttgaccgatttacttg
> atgaatttggtaccgaagaagggggatttcgagatgctttaccggaagga
> acgaatttccgggttgagaataaaaaattctattttgacattggacagaa
> taaaattggtgtttttatgcgtatatcagaggtaaaaagtagtacgcgtt
> catcgatcaccattccagaaagatcatgggctcgttttcgtgacatattt
> gtacaggtgatgaaagtggtgaaaaaactacaacaacaattactacgggt
> accaaatcaagtaaatcacaacaagaatcatcatcatcatcagcaacaac
> agcatcaacgtcatcatcatcaacatcggctaaataatttcaaacaaaac
> aaaacaaaaaactcaaatcaaatcaactcaaaattatcgaataattaatt
> gacaaaaacaaaaacaaaaaaaaaa
>> BQ
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15
> 15 15 15 15 15 15 15 15 15 15 15 15 15 15 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
---
