Hi Tim,
Though I am not so sure, lots of references seem to hint pPS904 was
originally known as pKG5 in this article: Kahana, J., Schnapp,
B.J.,Silver, P.A. (1995) PNAS 92:9707-9711. In its materials section,
the author wrote the following:
Plasmid pKG5 was constructed as follows: wild-type GFP was PCR-
amplified from plasmid TU65 (5) using the 5' Xho I-linked primer
CCGCTCGAGCTATGAGTAAAGGAGAAGA and the 3' 17 primer. The PCR product was
cut with Xho I and Pst I (New England Biolabs).
The NUF2 open reading frame was amplified from plasmid pPS511 (4)
using the BamHI-linked 5' primer GCGGATCCATGAGTAGGAATCAAGATGTC and the
in-frame, XhoI-linked 3' primer
CCCTCGAGCTTGCATATATTCGAGCATCCCTCGAGCTTGCATATATTCGAGCAT.
The PCR product was cut with BamHI and Xho I. The two fragments were
ligated together into plasmid pPS293 (a
2-gm URA3 vector with the GALl promoter sequence) cut with BamHI and
Pst I.
So the backbone of pPS904 is just double digested pPS293, whereas the
insert is concatenation of GFP and NUF2.
Cheers,
Wei
__________________________________
Wei Chen
Laboratory of Yeast Genetics, 6131
Department of Microbiology
College of Life Sciences,
Wuhan University
Wuhan, 430072
PR. China
-------------- next part --------------
An HTML attachment was scrubbed...
URL: http://www.bio.net/bionet/mm/yeast/attachments/20080315/a754dba8/attachment.html
