IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

[Yeast] pAC45 (pPS904) sequence?

Wei Chen via yeast%40net.bio.net (by chenpv from gmail.com)
Fri Mar 14 13:13:52 EST 2008


Hi Tim,

Though I am not so sure, lots of references seem to hint pPS904 was  
originally known as pKG5 in this article: Kahana, J., Schnapp,  
B.J.,Silver, P.A. (1995) PNAS 92:9707-9711. In its materials section,  
the author wrote the following:

Plasmid pKG5 was constructed as follows: wild-type GFP was PCR- 
amplified from plasmid TU65 (5) using the 5' Xho I-linked primer  
CCGCTCGAGCTATGAGTAAAGGAGAAGA and the 3' 17 primer. The PCR product was  
cut with Xho I and Pst I (New England Biolabs).
The NUF2 open reading frame was amplified from plasmid pPS511 (4)  
using the BamHI-linked 5' primer GCGGATCCATGAGTAGGAATCAAGATGTC and the  
in-frame, XhoI-linked 3' primer  
CCCTCGAGCTTGCATATATTCGAGCATCCCTCGAGCTTGCATATATTCGAGCAT.
The PCR product was cut with BamHI and Xho I. The two fragments were  
ligated together into plasmid pPS293 (a
2-gm URA3 vector with the GALl promoter sequence) cut with BamHI and  
Pst I.

So the backbone of pPS904 is just double digested pPS293, whereas the  
insert is concatenation of GFP and NUF2.

Cheers,

Wei
__________________________________

Wei Chen

Laboratory of Yeast Genetics, 6131
Department of Microbiology
College of Life Sciences,
Wuhan University
Wuhan, 430072
PR. China


-------------- next part --------------
An HTML attachment was scrubbed...
URL: http://www.bio.net/bionet/mm/yeast/attachments/20080315/a754dba8/attachment.html


More information about the Yeast mailing list

Send comments to us at biosci-help [At] net.bio.net