IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

please tell me what is the shortest active fragment of pgk

[gb2312] shude yang sdyang68 at yahoo.com.cn
Thu Jul 3 22:23:06 EST 2003


Hello:

I have spent half a year to modify a expression vector
of yeast. A important part of work was to insert a
promoter of phosphoglycerate kinase (PGK) and a PGK
terminator into pFL39.However, after having inserted a
630bp- length fragment of PGK promoter drevied from
another vector, I found that there were various kind
of PGK promoters with different length in database,
such as of 1484bp, 1496bp, 603bp, 400bp(it is called
active site of PGK promoter) fragment. Therefore, I am
anxiously worried about whether the PGK promoter of
603bp which I used in my work is active enough to
initiate transcription. As knowing little about the
characteristics of promoter structure, I hope you can
give a urgent help. The sequence of PGK promoter I
used is showed as follows:

 

CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGATAATTACTTCCTTGATGATCTGTAAAAAAGAGAAAAAGAAAGCATCTAAGAACTTGAAAAACTACGAATTAGAAAAGACCAAATATGTATTTCTTGCATTGACCAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTCTACTAAACTAAACCACCCCCTTGGTTAGAAGAAAAGAGTGTGTGAGAACAGGCTGTTGTTGTCACACGATTCGGACAATTCTGTTTGAAAGAGAGAGAGTAACAGTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATAGCATGTGGTACTAAACCCTTTCCCGCCATTCCAGAACCTTCGATTGCTTGTTACAAAACCTGTGAGCCGTCGCTAGGACCTTGTTGTGTGACGAAATTGGAAGCTGCAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTCAGTTTTGTTCTTTTTGCAAACAAATCACGAGCGACGGTAATTTCTTTCTCGATAAGAGGCCACGTGCTTTATGAGGGTAACATCAATTCAAGATCTGAATTCC

 

Thank you very much

Shude Yang
______________O_________oO_____________oO______o_______oO___________________
YEAST bionet newsgroup see: http://www.bio.net/hypermail/YEAST/
YEAST e-mail: messages sent to yeast at net.bio.net
subscribe:   mailto:biosci-server at net.bio.net and say: subscribe yeast
unsubscribe: mailto:biosci-server at net.bio.net and say: unsubscribe yeast
YEAST on the WWW: http://www.yeastgenome.org/VL-yeast.html
Newsgroup Moderator SGD Curators: yeast-biosci-moderator at yeastgenome.org






More information about the Yeast mailing list

Send comments to us at biosci-help [At] net.bio.net