IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

More sequence updates from SGD

Anand Sethuraman anand at genome.stanford.edu
Fri Jan 10 18:33:44 EST 2003


Hello,

	Chromosomal systematic sequences of Chr II, Chr VII, Chr X, Chr XI, 
Chr XIII, Chr XIV, and Chr XV have been recently updated by SGD.  Due to 
these sequence updates, systematic sequences of the following ORFs have 
been changed in SGD: MMS4/YBR098W, YBR100W, RIM8/YGL045W, YGL046W, 
MET13/YGL125W, MND1/YGL183C, YJL018W, MPS3/YJL019W, CSE4/YKL049C, 
PTK1/YKL198C, YKT9/YKL199C, RAD52/YML032C, LAP3/YNL239W, YOL002C, 
YVC1/YOR087W, and YOR088W.  These sequence changes have been described 
in detail in the sequence update report included at the bottom of this 
message.  These details are also available online at:

					http://genome-www.stanford.edu/Saccharomyces/sequenceupdates.shtml

We are currently processing sequence updates for Chr III and Chr VI.  
Many of these changes were reported to SGD by yeast researchers, they 
have all been specifically acknowledged in the sequence update report 
included at the bottom of this message.  The remainder of the changes 
were re-sequenced by the SGD project.  We acknowledge Katja Schwartz of 
the Botstein Lab for excellent assistance.  Also, all these sequence 
updates have been submitted to GenBank, or communicated to MIPS for them 
to update EU regions.  We thank all the members of the yeast community 
for their efforts to make the S. cerevisiae genome sequence as accurate 
as possible.  Please e-mail yeast-curator (yeast-
curator at genome.stanford.edu)  if you have any questions or comments.

Regards,
Anand
*****************************************************
Anand Sethuraman Ph. D., Scientific Curator
Saccharomyces Genome Database
Department of Genetics
Stanford University School of Medicine
Stanford, CA 94305-5120
Ph: (650)724-9959    Fax:(650)723-7016
E-mail: yeast-curator at genome.stanford.edu
http://genome-www.stanford.edu/Saccharomyces/
******************************************************

Sequence Update Report
====================

MMS4/YBR098W, and YBR100W: Deletion of C at position 442868
==========================

Query:      1 AACGATTTCTATTACCCCTGTGATCCCAAAATAGTTGAAGAAAAC-GTTT 49
               ||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 442823 AACGATTTCTATTACCCCTGTGATCCCAAAATAGTTGAAGAAAACCGTTT 442872


- deletion of 'C' 442868 on chr 2 will merge MMS4/YBR098W, YBR099C, 
YBR100W

- current coordinates of MMS4/YBR098W: 441473 (start) 442888 (stop)
- current coordinates of YBR099C: 443266 (start) 442883 (stop)
- current coordinates of YBR100W: 443211 (start) 443549 (stop)

- coordinates of the fused ORF MMS4/YBR098W, YBR100W will be 441473 
(start) - 443548 (stop)	

- YBR098W source exon1 1-1416
(- YBR099C source exon1 1-384)
- YBR100W source exon1 1-339
- Source exon 1 of the fused ORF MMS4/YBR098W, YBR099C, YBR100W = 1-2076

- protein length of YBR098W = 471 amino acids
(- protein length of YBR099C = 127 amino acids)
- protein length of YBR100W = 112 amino acids
- protein length of the fursed ORF MMS4/YBR098W, YBR100W = 691 aa

References:

1. Sequence verification in FY1679 (S288c derivative strain) background 
by SGD
2. W. Xiao, B. L. Chow, C. N. Milo Mms4, a putative transcriptional 
(co)activator, protects Saccharomyces cerevisiae cells from endogenous 
and environmental DNA damage  Mol Gen Genet 257 (1998) 6, 614-623
3. Personal communication from Jim Brown (james.brown at sstanford.edu)

RIM8/YGL045W:
=============

Due to a change to the systematic sequence of chromosome 7 (A insertion 
at 414883;
C insertion at 414910, CC insertion at 414983, and G deletion at
415042), YGL045W and YGL046W have been merged to one single ORF. RIM8 is 
the standard name for the new, elongated ORF after merging; YGL046W is 
now an alias of RIM8/YGL045W. Please note that the source exon of 
YGL046W may not be evenly divisible by 3 as there was a deletion of a 
single nucleotide at 415042. We thank Claude Gaillardin and Aaron P 
Mitchell for reporting this sequence error on Chr VII to SGD.

References:

1. Treton B, Blanchin-Roland S, Gaillardin C (2000) Mol Gen Gent 263 : 
505-513
2. Personal communication from Claude Gaillardin and Aaron P Mitchell

MET13/YGL125W Involves sequence change:
=============

1. Insertion of A after the 'A' 273049
2. Insertion of CG after the A at 273061
3. Substitution of AC at 273111-273112 with CA
4. Substitution of AT at 273208-273209 with GC

Query:      1 
CCGGAGTTGCCTAACAAAGACGTGAAGCTTGATCTCGAGTATTTGAAGCAGAAGATCGAC 60
               |||||||||||||||||||||||||||||||||||||||||||||| 
|||||||||||||
Sbjct: 273004 
CCGGAGTTGCCTAACAAAGACGTGAAGCTTGATCTCGAGTATTTGA-GCAGAAGATCGA- 273062

Query:     61 
GCCGGCGGCGACTTCATCATCACTCAGATGTTTTACGATGTTGATAATTTCATCAACTGG 120
                |||||||||||||||||||||||||||||||||||||||||||||||||  
||||||||
Sbjct: 273063 
-CCGGCGGCGACTTCATCATCACTCAGATGTTTTACGATGTTGATAATTTACTCAACTGG 273120

Query:    121 
TGTTCCCAAGTTAGAGCTGCGGGCATGGACGTGCCCATTATTCCCGGGATCATGCCGATC 180
               
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 273121 
TGTTCCCAAGTTAGAGCTGCGGGCATGGACGTGCCCATTATTCCCGGGATCATGCCGATC 273180

Query:    181 
ACTACCTACGCGGCCTTCTTGAGAAGGGCCCAATGGGGCCAAATCTCCATCCCTCAACAT 240
               |||||||||||||||||||||||||||  
|||||||||||||||||||||||||||||||
Sbjct: 273181 
ACTACCTACGCGGCCTTCTTGAGAAGGATCCAATGGGGCCAAATCTCCATCCCTCAACAT 273240

Coordinates should change from 272524 - 274323 to 272524 - 274326
Source exon1 should change from 1 - 1800 to 1 - 1803

References:

1. Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., 
Hieter, P., and Boeke, J. D. (1998) Yeast 14, 115-132
2. Contact Dean Appling (dappling at mail.utexas.edu) and Sherwin Chan 
(chansy at mail.utexas.edu)

MND1/YGL183C Annotation change - the first ATG is used; also there is an 
intron
============  following this first ATG

1. Current cordinates 157071 - 156547 should change to 157289 - 156547
2. Current source exon1 = 1 - 525
3. New source exon1 = 1 - 3
    New source intron1 = 4 - 86
    New source exon2 = 87 - 743

References:

1. Tsubouchi et al. Mol Cell Biol 2002 May;22(9):3078-88, PMID: 11940665
2. Personal communication from Pinar Kondu at YPD (pk at incyte.com)


MPS3/YJL019W and YJL018W; Involves sequence change:
========================

Query:      1 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAGGATTTGC 50
               ||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 404401 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAG-ATTTGC 404449

1. Insertion of 'G' after the 'G' at 404443
2. As a consequence MPS3/YJL019W is erased and YJL019W and YJL018W are 
merged
3. Current coordinates are:

MPS3/YJL019W: 402593 - 404455; source exon1 = 1 - 1863
YJL018W: 404326 - 404640; source exon1 = 1- 315

4. Merged ORF MPS3/YJL019W = 402593 - 404641; source exon 1 = 1 - 2049
5. YJL018W becomes 'Merged' ORF type and is kept as an alias of 
MPS3/YJL019W

References:

1. Personal communication from Mark Winey (Mark.Winey at Colorado.edu) and 
Sue Jaspersen (jasperse at spot.colorado.edu); has been verified in S288c


CSE4/YKL049C: Insertion of G after 346324 on Chr XI
============


Query:     90 
GTCTCCTGCAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGC 31
               |||||||| 
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 346317 
GTCTCCTG-AAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGC 346375

Query:     30 AGAACTAACCCATTGTTGTTTACTTGACAT 1
               ||||||||||||||||||||||||||||||
Sbjct: 346376 AGAACTAACCCATTGTTGTTTACTTGACAT 346405

- insertion of 'C' after the G at 346324 (on Watson) on chromosome 11
- coordinates 346130 (start) 345717 (stop) change to 346406 (start) and 
345717 (stop)
- source exon1 1-414 changes to 1-690
- protein changes from its current predicted length of 137 aa to 229 aa

References:

1. Sequence verification in FY1679 (S288c derivative strain) background 
by SGD
2. Stoler S, et al. (1995) A mutation in CSE4, an essential gene 
encoding a novel chromatin-associated protein in yeast, causes 
chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 
9(5):573-86
3. Personal communication from Sam Stoler (stoler at biochem.umass.edu), 
Judith Sharp (jsharp at uclink4.berkeley.edu), Vivien Measday 
(vmeasday at cmmt.ubc.ca), Sue Biggins (sbiggins at fhcrc.org)

PTK1/YKL198C and YKT9/YKL199C: Deletion of G at position 69156 (Watson) 
on chr XI
=============================

Query:    35 GTGGATCCGTG-TGGTACCAGTCTGAGATACCAAAA 1
              ||||||||||| ||||||||||||||||||||||||
Sbjct: 69145 GTGGATCCGTGGTGGTACCAGTCTGAGATACCAAAA 69180


- deletion of 'G' at position 69156 (on Watson) on chr 11 will merge 
YKL198C AND YKL199C

- current coordinates of YKL198C: 70220 (start) 69021 (stop)
- current coordinates of YKL199C: 69109 (start) 68270 (stop)
- coordinates of the fused ORF YKL198C and YKL199C will be 70219 
(start) - 68270(stop)	

- YKL198C source exon1 1-1200
- YKL199C source exon1 1-840
- Source exon 1 of the fused ORF YKL198C/YKL199C = 1-1950

- protein length of YKL198C = 399 amino acids
- protein length of YKL199C = 279 amino acids
- protein length of the fursed ORF YKL198C/YKL199C = 649 amino acids


References:

1. Sequence verification in FY1679 (S288c derivative strain) background 
by SGD
2. Personal communication from Gerald Manning (gerald-manning at sugen.com) 
and Valerie Dennis (vdenis at leland.stanford.edu)

RAD52/YML032C Annotation change
=============

The start site of RAD52/YML032C has been moved 99 nt downstream from 
214029 to 213930.  In S. paradoxus, S. bayanus, and S. mikatae, the 
first in-frame ATG aligns with the third start codon in S. cerevisiae 
(there is another ATG between the current one at 214029 and the new 
proposed one).  In addition, mutational analysis by the Rothstein lab 
(A. Antunez de Mayolo, M. Lisby, N. Erdeniz), additional sequence 
analysis done by Tanja Thybo Frederiksen in Uffe Mortensen's lab, and 
mRNA analysis described in Adzuma et al ((1984) Mol Cell Biol 4:2735-44) 
are consistent with the downstream ATG being used (Rodney Rothstein and 
Dennis Livingston, personal communication).

Coordinates change from 214029 - 212515 to 213930 - 212515
Source exon1 changes from 1 - 1515 to 1 - 1416

References:

1. Adzuma et al ((1984) Mol Cell Biol 4:2735-44
2. Personal communication from Rodney Rothstein 
(rothstein at cancercenter.columbia.edu) and Dennis Livingston 
(livin001 at maroon.tc.umn.edu)

LAP3/YNL239W  Annotation change
============

Gal6p purified from yeast indicates that native Gal6p is translated from 
the second translation start codon (454 aa and not 483 aa; see the 
reference below). Therefore, the start site of LAP3/YNL239W has been 
moved 87 nt downstram from 200481 to 200568.

Reference:

Zheng W, et al. (1997) The cysteine-peptidase bleomycin hydrolase is a 
member of the galactose regulon in yeast. J Biol Chem 272(48):30350-5.

YOL002C: Annotation change - the second ATG should be used
========

Coordinates should change from 324394-323411 to 324364-323411

Source exon1 changes from 1-984 to 1-954

References:

1. Karpichev IV, et al. (2002) Multiple Regulatory Roles of a Novel
Saccharomyces cerevisiae Protein, Encoded by YOL002c, in Lipid and
Phosphate Metabolism. J Biol Chem 277(22):19609-17
2. Personal communication from Gillian Small (gmsbh at cunyvm.cuny.edu)

YVC1/YOR087w and YOR088w: Insertion of T after the 'A' at 488439 on Chr 
XV
========================

Query:      1 GCGCCTGTATACCAAAATTATTTGCAGATGATCTTCTCATTTTTGTTTCTA 51
               |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 488401 GCGCCTGTATACCAAAATTATTTGCAGATGATCTTCTCA-TTTTGTTTCTA 488450


- insertion of 'T' after the 'A' at 488439 on chr 15 will merge YOR087W 
and YOR088W

- current coordinates of YOR087W: 487708 (start) 488451 (stop)
- current coordinates of YOR088W: 488286 (start) 489734 (stop)
- coordinates of the fused ORF YOR087W and YOR088W will be 487708 
(start) - 489735 (stop)	

- YOR087W source exon1 1-744
- YOR088W source exon1 1-1449
- Source exon1 of the fused ORF YOR087W/YOR088W = 1-2028

- protein length of YOR087W = 247 amino acids
- protein length of YOR088W = 482 amino acids
- protein length of the fursed ORF YOR087W/YOR088W = 675 amino acids


References:

1. Sequence verification in FY1679 (S288c derivative strain) background 
by SGD
2. Palmer CP, et al. (2001) A TRP homolog in Saccharomyces cerevisiae 
forms an intracellular Ca(2+)-permeable channel in the yeast vacuolar 
membrane. Proc Natl Acad Sci U S A 98(14):7801-5



______________O_________oO_____________oO______o_______oO___________________
YEAST bionet newsgroup see: http://www.bio.net/hypermail/YEAST/
YEAST e-mail: messages sent to yeast at net.bio.net
subscribe: e-mail biosci-server at net.bio.net with: subscribe yeast
unsubscribe: e-mail biosci-server at net.bio.net with: unsubscribe yeast
YEAST on the WWW: http://genome-www.stanford.edu/Saccharomyces/VL-yeast.html
problems with the YEAST newsgroup? E-mail the moderator: francis at cmmt.ubc.ca





More information about the Yeast mailing list

Send comments to us at biosci-help [At] net.bio.net