IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

Sequence updates from SGD

Anand Sethuraman anand at genome.stanford.edu
Sat Jan 4 18:24:52 EST 2003


Hello,

	Chromosomal systematic sequences of Chr I, Chr II, Chr IV, Chr VII, 
and Chr X have been recently updated by SGD.  Due to these sequence 
updates, systematic sequences of the following ORFs have been changed in 
SGD:   YAL014C, YAL023C, YDR325W, YDR494W, YBR086C, YBR098W, YBR100W, 
YGL159W, YJL018W, and YJL019W.  These sequence changes have been 
described in detail in the sequence update report included at the bottom 
of this message.  These details are also available online at:

					http://genome-www.stanford.edu/Saccharomyces/sequenceupdates.shtml

We are currently processing updates for Chr III, Chr VI, Chr XI, Chr 
XIII, and Chr XV.  Many of these changes were reported to SGD by yeast 
researchers, they have all been specifically acknowledged in the 
sequence update report included at the bottom of this message.  The 
remainder of the changes were re-sequenced by the SGD project.  We 
acknowledge Katja Schwartz of the Botstein Lab for excellent 
assistance.  Also, all these sequence updates have been submitted to 
GenBank, or communicated to MIPS for them to update EU regions.  We 
thank all the members of the yeast community for their efforts to make 
the S. cerevisiae genome sequence as accurate as possible.  Please 
e-mail yeast-curator (yeast-curator at genome.stanford.edu)  if you have 
any questions or comments.

Regards,
Anand
*****************************************************
Anand Sethuraman Ph. D., Scientific Curator
Saccharomyces Genome Database
Department of Genetics
Stanford University School of Medicine
Stanford, CA 94305-5120
Ph: (650)724-9959    Fax:(650)723-7016
E-mail: yeast-curator at genome.stanford.edu
http://genome-www.stanford.edu/Saccharomyces/
******************************************************

									Sequence Update Report
									====================

SYN8/UIP2/YAL014C
=================

Query:    588 
AACGATCTCATTATTAAGGTCCAGCGAAATGTCATGAGTCCTCCCAATAGACTGAGACAG 529
               ||||||||||| 
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 128431 
AACGATCTCAT-ATTAAGGTCCAGCGAAATGTCATGAGTCCTCCCAATAGACTGAGACAG 128489

1. Insertion of 'T' after the 'T' at 128441
2. Coordinates should change from 129017 - 128400 to 129018 - 128251
3. Source exon1 changes from 1 - 618 to 1 - 768

References:

1. Lewis, M.J. and Pelham, H.R.B. (2002) A new yeast endosomal SNARE 
related to mammalian syntaxin 8.  Traffic 3, 922-929

2. Lena Burri and Trevor Lithgow - unpublished data (manuscript in 
preparation).

3. personal communication from Trevor Lithgow 
(t.lithgow at unimelb.edu.au), Hugh Pelham (hp at mrc-lmb.cam.ac.uk), and 
mjl1 at mrc-lmb.cam.ac.uk

PMT2/FUN25/YAL023C Involves sequence change:
==================

1. Insertion of CC after the C 108137
2. Insertion of G after the G at 108143

Query:    420 
TTCCCCAGAAGGGAAGTCCCAAGAACCGTTGTAGCCTGCCAAATAACCAGACAACCCGAC 361
               ||||  |||||| 
|||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 108134 
TTCC--AGAAGG-AAGTCCCAAGAACCGTTGTAGCCTGCCAAATAACCAGACAACCCGAC 108190


+400bp  tgg gac ttc ctt ctg gaa att tac cca
          W   D   F   L   L   E   I   Y   P
+400bp  tgg gac ttc cCt tct ggG Gaa att tac cca
	    W   D   F   P   S   G   E   I   Y   P

Coordinates 108550 - 106274 change to 108553 - 106274

Source exon1 changes from 1 - 2277 to 1 - 2280

References:

1. Personal communication from Verena Girrbach 
(verena.girrbach at biologie.uni-regensburg.de)

IST2/YBR086C: Substitution of TAC at 422273 - 422271 with ATC on Chr II
============

Query:     49 TGGGCCGTTATAAATTTGCTTGTAGAAAATTTCCAACGCAAAACAATATA 1
               ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422250 TGGGCCGTTATAAATTTGCTTGTAGAAAATTTCCAACGCAAAACAATATA 422299

- sequence at 422271 - 422273 changes from GTA to GAT (on Watson)
- coordinates 422999 (start) 420159 (stop) do not change
- source exon1 1-2841 does not change
- amino acid residue 243 changes from Tyr to Ile

References:

1. Sequence verification in FY1679 (S288c derivative strain) background 
by SGD
2. Personal communication from Anna Kurlandzka 
(ania218 at poczta.ibb.waw.pl)

MMS4/YBR098W, and YBR100W: Deletion of C at position 442868
==========================

Query:      1 AACGATTTCTATTACCCCTGTGATCCCAAAATAGTTGAAGAAAAC-GTTT 49
               ||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 442823 AACGATTTCTATTACCCCTGTGATCCCAAAATAGTTGAAGAAAACCGTTT 442872


- deletion of a 'C' 442868 on chr 2 will merge MMS4/YBR098W, YBR099C, 
YBR100W

- current coordinates of MMS4/YBR098W: 441473 (start) 442888 (stop)
- current coordinates of YBR100W: 443211 (start) 443549 (stop)

- coordinates of the fused ORF MMS4/YBR098W, YBR100W will be 441473 
(start) - 443548 (stop)	

- YBR098W source exon1 1-1416
(- YBR099C source exon1 1-384)
- YBR100W source exon1 1-339
- Source exon 1 of the fused ORF MMS4/YBR098W, YBR099C, YBR100W = 1-2076

- protein length of YBR098W = 471 amino acids
- protein length of YBR100W = 112 amino acids
- protein length of the fursed ORF MMS4/YBR098W, YBR100W = 691 aa

References:

1. Sequence verification in FY1679 (S288c derivative strain) background 
by SGD
2. W. Xiao, B. L. Chow, C. N. Milo Mms4, a putative transcriptional 
(co)activator, protects Saccharomyces cerevisiae cells from endogenous 
and environmental DNA damage  Mol Gen Genet 257 (1998) 6, 614-623
3. Personal communication from Jim Brown (james.brown at sstanford.edu)


YCG1/YDR325W Involves sequence change: also uses the second ATG
============

Query:       1 ATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACA-CCGC 40
                |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1117069 ATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACAGCCGC 1117109

1. Deletion of G at 1117105
2. The second ATG is used - 16 aa shorter;
3. Coordinates should change from 1117069 - 1120224 to 1117116 - 1120223
4. Surce exon1 changes from 1 - 3156 to 1 - 3108

References:

1. Lavoie et al. 2002 Journal of Cell Biology 156:805-815
2. Personal communication from Denise Bertsch 
(denise.bertsch at m.cc.utah.edu)


RSM28/YDR494W Involves sequence change:
=============

1. SGD contains an additional tandem repeat (16-mer; GATCCTCCTTGATTTT) 
between
1437732 - 1437747; delete this

2. Change the stop coordinate to make it a longer ORF

Coordinates should change from 1436917 - 1437783 to 1436917 - 1438002

Source exon1 changes from 1 - 867 to 1 - 1086


References

1. Personal communication from Tom Fox (tdf1 at cornell.edu)
2. GenBank accession number AF459095

YGL059W: Insertion of A after the 'A' at 393525 on Chr VII
=======

Query:      1 TAATTGAATTGTTAAAGCGGTCTTTTAGATACAAGCTTGGGATTGGGTTAG 51
               ||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 393511 TAATTGAATTGTTAA-GCGGTCTTTTAGATACAAGCTTGGGATTGGGTTAG 393560


- insertion of an 'A' after the 'A' at position 393525 on chromosome 7 
will make it longer
- coordinates 392223 (start) 393560 (stop) change to 392223 (start) and 
393698 (stop)
- source exon1 1-1338 changes to 1-1476
- protein changes from its current predicted length of 445 aa to 491 aa

References:

1. Sequence verification in FY1679 (S288c derivative strain) background 
by SGD
2. Blandin et al. (2000) FEBS Lett. 487: 31-36
3. Personal communication from H. Y. Steensma 
(steensma at rulbim.leidenuniv.nl)


MPS3/YJL019W and YJL018W; Involves sequence change:
========================

Query:      1 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAGGATTTGC 50
               ||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 404401 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAG-ATTTGC 404449

1. Insertion of 'G' after the 'G' at 404443
2. As a consequence MPS3/YJL019W is erased and YJL019W and YJL018W are 
merged
3. Current coordinates are:

MPS3/YJL019W: 402593 - 404455; source exon1 = 1 - 1863
YJL018W: 404326 - 404640; source exon1 = 1- 315

4. Merged ORF MPS3/YJL019W = 402593 - 404641; source exon 1 = 1 - 2049
5. YJL018W becomes 'Merged' ORF type and is kept as an alias of 
MPS3/YJL019W

References:

1. Personal communication from Mark Winey (Mark.Winey at Colorado.edu) and 
Sue Jaspersen (jasperse at spot.colorado.edu); has been verified in S288c




______________O_________oO_____________oO______o_______oO___________________
YEAST bionet newsgroup see: http://www.bio.net/hypermail/YEAST/
YEAST e-mail: messages sent to yeast at net.bio.net
subscribe: e-mail biosci-server at net.bio.net with: subscribe yeast
unsubscribe: e-mail biosci-server at net.bio.net with: unsubscribe yeast
YEAST on the WWW: http://genome-www.stanford.edu/Saccharomyces/VL-yeast.html
problems with the YEAST newsgroup? E-mail the moderator: francis at cmmt.ubc.ca





More information about the Yeast mailing list

Send comments to us at biosci-help [At] net.bio.net