IUBio

[adenine] to obtain white ade2- strain?

news at mlucom4.urz.uni-halle.de news at mlucom4.urz.uni-halle.de
Wed Aug 4 10:54:19 EST 1999


biosci-request at net.bio.net, ilya ilya wrote:
> 
> Hi,
> I'm growing S. cerevisiae up to stationary phase (OD600 about 6). The
> red color
> produced by the ade2- strain interferes with OD measurement. Are
> anybody known how
> many adenine should I add to YPD medium to obtain "white" cell culture?
> 
> Thanks in advance
> ilya
> _____________________________________________________________
> Do You Yahoo!?
> Free instant messaging and more at http://messenger.yahoo.com


Hi,

we use 100 mg/L, but it doesn't work in all cases. So far we
could  not figure out why the cells still turn red sometimes.

Ricky

ATGCATCGTGATCAATCGTATCCCGTGGAAGTACGTACGTAGCACGG

Frederik Boernke
Research Group of  Molecular Plant Physiology
Institute for Plant Genetics and Crop Plant Research (IPK)
Corrensstr. 3
06466 Gatersleben
Tel.  039482 -5 321
Fax. 039482 -5 515
http://www.ipk-gatersleben.de






______________O_________oO_____________oO______o_______oO___________________
YEAST bionet newsgroup see: http://www.bio.net/hypermail/YEAST/
YEAST e-mail: messages sent to yeast at net.bio.net
subscribe: e-mail biosci-server at net.bio.net with: subscribe yeast
unsubscribe: e-mail biosci-server at net.bio.net with: unsubscribe yeast
YEAST on the WWW: http://genome-www.stanford.edu/Saccharomyces/VL-yeast.html
problems with the YEAST newsgroup? E-mail the moderator: francis at cmmt.ubc.ca




More information about the Yeast mailing list

Send comments to us at biosci-help [At] net.bio.net