IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

pEG202

Mike Watson ~mw23671 at glaxo.com
Tue Jan 7 05:54:42 EST 1997


GAATTCCCGGGGATCCGTCGACCATGGCGGCCGCTCGAGTCGACCTGCAG

This is the sequence through the polylinker.  The EcoR1 site 
at the beginning is in frame, thus the GAA = Glu.

Mike



More information about the Yeast mailing list

Send comments to us at biosci-help [At] net.bio.net