IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

aaaatttt repeats

suter at de.dbp.MPG.MPIZ-KOELN.VAX suter at de.dbp.MPG.MPIZ-KOELN.VAX
Tue May 26 02:29:27 EST 1992


dear colleagues,

in the past few weeks i have cloned a piece of tobacco dna which has one 
striking feature: it contains three repeated sequences within a stretch
of about 100 bp. I have compared this repeat with the databases: however,
nothing obvious came up. perhaps anybody out there could help ? I would be 
especially pleased with info on how to attack the databases with such a small
sequence: any useful ideas ?

the repeat is:

	TACTTGTTGGCGTAAAATTTTGCA

especially the AAAATTTT box looks  familiar (several co-workers said
this also) and I wondered whether any of the bells in your brains will also
start clanging if you see it.Is it a restriction site ? a binding site ? hmmm...
any suggestions welcome.
 
thanx ! clemens suter-crazzolara



More information about the Plantbio mailing list

Send comments to us at biosci-help [At] net.bio.net