IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

aaaa tttt repeat

suter at de.dbp.MPG.MPIZ-KOELN.VAX suter at de.dbp.MPG.MPIZ-KOELN.VAX
Wed Jul 1 16:17:05 EST 1992


hi there,

after having some problems trying to reach the newsgroups, here is a question
which maybe already popped up... i would be very pleased to recieve some
advice.
i have (again) cloned a piece of tobacco dna,which has no known function
but an interesting feature: in a 200 bp stretch there are two large repeats
of 100 bp. These contain each three repeats:

	TACTTGTTGGCGTAAAATTTTGCAC

any ideas what these sequences are, or how i could analyze them ? does anybody
know what this AAAA-TTTT element is ?

Question 2: this fragment is directly associated with
an integrated T-DNA. It could be that the duplication is a result
of abberant T-DNA intergration, of which i already found a few. Did any
of you observe similar effects ??

if possible, reply directly to my e-mail address.

cheers ! clemens
----------------------------------> cut here <----------------------------------
Clemens Suter-Crazzolara, PhD
Max-Planck-Institut fuer Zuechtungsforschung
Abteilung Genetische Grundlagen der Zuechtungsforschung
Carl-von-Linne Weg 10
5000 Koeln 30
Tel. xx49-221-5062.221           fax. xx49-221-5062.213
-------------------------------> end of message <-------------------------------



More information about the Plantbio mailing list

Send comments to us at biosci-help [At] net.bio.net