hi there,
after having some problems trying to reach the newsgroups, here is a question
which maybe already popped up... i would be very pleased to recieve some
advice.
i have (again) cloned a piece of tobacco dna,which has no known function
but an interesting feature: in a 200 bp stretch there are two large repeats
of 100 bp. These contain each three repeats:
TACTTGTTGGCGTAAAATTTTGCAC
any ideas what these sequences are, or how i could analyze them ? does anybody
know what this AAAA-TTTT element is ?
Question 2: this fragment is directly associated with
an integrated T-DNA. It could be that the duplication is a result
of abberant T-DNA intergration, of which i already found a few. Did any
of you observe similar effects ??
if possible, reply directly to my e-mail address.
cheers ! clemens
----------------------------------> cut here <----------------------------------
Clemens Suter-Crazzolara, PhD
Max-Planck-Institut fuer Zuechtungsforschung
Abteilung Genetische Grundlagen der Zuechtungsforschung
Carl-von-Linne Weg 10
5000 Koeln 30
Tel. xx49-221-5062.221 fax. xx49-221-5062.213
-------------------------------> end of message <-------------------------------